English site

CDS : HMPREF0693_0741

CDS Description

CDSHMPREF0693_0741
Product nameNAD(P)H dehydrogenase (quinone)
Gene nameacpD
ContigACLE01000025
location42633..43253
NBRC No.105697
MicrobeProteus mirabilis
Current status
>HMPREF0693_0741 NAD(P)H dehydrogenase (quinone)
MNKLLVLKSSILENYSHSNKMADYLIENWQKHHQNDLITLRDLAKDPIPVLDQATLFAFG
KDTAMLSEQQKAARALSDTLINELKAHDIIVITAPMYNFSIPSQLKHYIDFIARAGETFK
YTETGSVGLLEDKQVIVLTSRGGIHKGQPSDLIIPYLTQFLSFIGINNVQFILTEGTALG
EEYAQQSHAQAQKEIDLIINKEIMIK


>HMPREF0693_0741 NAD(P)H dehydrogenase (quinone)
ATGAACAAGCTTCTTGTACTAAAATCCAGTATTTTAGAAAATTACTCGCACAGCAATAAA
ATGGCTGACTATCTAATAGAAAATTGGCAAAAGCATCATCAAAATGATCTCATTACCCTA
CGTGATCTGGCAAAAGATCCCATTCCTGTTTTAGATCAAGCCACATTATTTGCTTTTGGC
AAAGATACGGCTATGTTATCGGAACAACAAAAAGCCGCTAGAGCACTCTCTGATACATTA
ATTAATGAATTAAAAGCACATGATATTATTGTGATCACGGCGCCTATGTATAATTTCTCC
ATCCCTTCTCAATTAAAACACTATATCGATTTTATTGCGCGTGCAGGCGAAACTTTTAAA
TATACTGAAACAGGGTCAGTCGGATTACTTGAAGATAAGCAAGTTATTGTATTAACGAGT
CGTGGTGGGATCCATAAAGGACAACCCTCTGATTTAATTATTCCATATCTAACACAATTT
TTATCATTTATTGGTATTAATAATGTACAGTTTATTCTCACCGAGGGTACTGCGCTAGGC
GAAGAATATGCCCAGCAGTCACATGCTCAAGCACAAAAAGAAATAGATTTAATAATTAAT
AAAGAAATAATGATAAAATAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)