English site

CDS : HMPREF9086_2280

CDS Description

CDSHMPREF9086_2280
Product namefmn-dependent NADH-azoreductase
Gene name
ContigAFHR01000043
location16397..17002
NBRC No.105718
MicrobeEnterobacter hormaechei
Current statusStandard Draft
>HMPREF9086_2280 fmn-dependent NADH-azoreductase
MSKVLVLKSSILAGYSQSGQLSDYFVEQWREQHTADEITVRDLAANPIPVLDGELVGALR
PSDAPLSPRQQEALALSDELIAELQAHDVIVINAPMYNFNIPTQLKNYFDLVARAGVTFR
YTENGPEGLVKGKRAIVLTSRGGIHKDTPTDLVAPYMTLFLGFIGITDVNFVFAEGIAYG
PEVATKAQTDAKAAIDSLVAA


>HMPREF9086_2280 fmn-dependent NADH-azoreductase
ATGAGCAAAGTATTAGTGTTGAAATCCAGTATTCTGGCAGGGTACTCACAGTCTGGTCAG
CTGTCCGACTATTTCGTTGAACAGTGGCGTGAACAGCATACCGCGGATGAAATCACCGTG
CGTGACCTGGCGGCAAACCCAATCCCTGTGCTGGACGGCGAGCTGGTTGGCGCGCTGCGT
CCGAGCGATGCGCCGCTTTCCCCGCGTCAGCAGGAAGCCCTGGCGCTCTCCGACGAGCTG
ATTGCTGAATTGCAGGCGCACGACGTTATCGTCATCAACGCCCCAATGTACAACTTCAAC
ATTCCTACCCAGCTGAAGAACTACTTCGACCTGGTCGCCCGCGCTGGCGTGACCTTCCGT
TACACCGAGAACGGCCCGGAAGGTCTGGTAAAAGGTAAACGCGCTATCGTCCTGACCAGC
CGCGGCGGTATTCACAAAGATACCCCAACCGACCTGGTTGCACCGTACATGACGCTGTTC
CTGGGCTTCATCGGCATTACCGACGTGAACTTCGTGTTCGCTGAAGGTATCGCTTACGGC
CCGGAAGTGGCCACCAAAGCACAGACCGACGCGAAAGCCGCTATCGACAGCCTGGTCGCA
GCGTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)