English site

CDS : I583_00829

CDS Description

CDSI583_00829
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigASVY01000002
location663558..664178
NBRC No.100709
MicrobeEnterococcus haemoperoxidus
Current status
>I583_00829 FMN-dependent NADH-azoreductase
MSKLLVVKAHPLTKEESRSVRALETFLESYKTQNPADEIDVLDVYADFVPEIDEELLSGW
GALRTGTEFTALNESQQTKVARFNELTDQFLGADKVVIANALWNLNVPTRLKAWVDTINV
AGKTFKYTEEGPKPLTNGKKALHIQSNGGFYEGQDFASQYVKGILNFIGVAEVDQLFIEG
IDHHPEKAEELLDAAMDQATTLGKTF


>I583_00829 FMN-dependent NADH-azoreductase
ATGTCAAAATTACTTGTTGTCAAAGCACACCCGCTTACTAAGGAAGAATCTCGTTCTGTC
CGAGCATTAGAAACTTTTTTAGAAAGTTATAAAACTCAAAACCCAGCTGATGAGATCGAC
GTACTGGATGTCTACGCTGATTTTGTTCCAGAAATTGATGAAGAATTACTTTCTGGTTGG
GGTGCGTTACGTACTGGTACTGAATTTACAGCTCTAAATGAAAGCCAACAAACAAAGGTT
GCTCGTTTCAACGAATTGACAGATCAATTCCTAGGCGCTGACAAAGTCGTTATCGCTAAC
GCTTTGTGGAATTTAAATGTCCCAACTCGCTTAAAAGCATGGGTTGATACGATCAATGTC
GCTGGCAAAACGTTTAAATATACTGAAGAAGGTCCTAAACCTTTAACTAATGGCAAAAAA
GCTTTGCATATTCAATCAAATGGCGGTTTTTATGAAGGTCAAGATTTTGCTTCTCAATAT
GTAAAAGGTATTTTAAACTTCATTGGTGTTGCTGAAGTCGATCAATTATTTATCGAAGGA
ATCGATCACCATCCGGAAAAAGCCGAAGAATTATTAGATGCAGCAATGGACCAAGCAACA
ACTTTAGGAAAAACATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)