English site

CDS : I586_01763

CDS Description

CDSI586_01763
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigASWB01000002
location575690..576310
NBRC No.100710
MicrobeEnterococcus moraviensis
Current status
>I586_01763 FMN-dependent NADH-azoreductase
MSKLLVVKAHPLTKEESRSVRALETFLESYQAQNPTDEIDVLDVYADFVPEIDEELLSGW
GALRTGTEFTALNESQQTKVARFNELTDQFLGADKVVIANALWNLNVPTRLKAWVDTINV
AGKTFKYTEEGPKPLTNGKKALHIQSNGGFYEGQDFASQYVKGILNFIGVSDVDQLFIEG
IDHHPEKAEELLGAAMDQATALGKTF


>I586_01763 FMN-dependent NADH-azoreductase
ATGTCAAAATTACTTGTAGTTAAAGCGCACCCACTTACTAAAGAAGAATCACGTTCTGTA
CGCGCGTTAGAAACATTTTTAGAAAGCTATCAAGCTCAAAATCCAACTGACGAGATCGAT
GTTCTGGATGTCTACGCTGACTTCGTTCCAGAAATCGACGAAGAATTACTTTCTGGCTGG
GGTGCCTTACGCACTGGTACTGAATTTACAGCTTTAAACGAAAGCCAACAAACAAAAGTT
GCACGTTTTAACGAATTAACAGACCAATTTCTTGGAGCAGATAAAGTAGTGATTGCTAAT
GCTTTATGGAATTTAAATGTACCTACTCGTTTAAAAGCATGGGTTGATACAATCAATGTA
GCTGGTAAAACGTTCAAATATACAGAAGAAGGTCCTAAACCTTTAACGAATGGTAAAAAA
GCATTACACATCCAATCAAATGGTGGCTTTTATGAAGGACAAGATTTTGCTTCTCAATAT
GTAAAAGGAATCTTGAATTTTATTGGTGTTTCTGACGTTGATCAATTATTCATCGAAGGA
ATCGACCACCATCCAGAAAAAGCTGAAGAATTATTAGGTGCTGCAATGGACCAAGCTACA
GCTTTAGGTAAAACATTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)