English site

CDS : I589_00740

CDS Description

CDSI589_00740
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigASWE01000001
location811399..812019
NBRC No.100711
MicrobeEnterococcus phoeniculicola
Current status
>I589_00740 FMN-dependent NADH-azoreductase
MSKLLVIKAHPLSAEESRSMKALDTFLTSYKETNPSDEVVVLDLYNEFIPEIDKDILTGW
TALRSGAAFDTLTADQQKKIARFNELTEQFLATDKVVVANAMWNLNVPTRLKAWFDTINV
AGKTFRYTEEGPKPLVEGKKALHIQSNGGFYEAQDASSQYVKGILNFIGVDQVDQLFIEG
IDHFPDRAEELLATAMTSATELGKTF


>I589_00740 FMN-dependent NADH-azoreductase
ATGTCAAAATTATTAGTTATCAAAGCACATCCATTATCTGCTGAGGAATCTCGCTCTATG
AAAGCTTTAGATACATTCTTAACTTCTTATAAAGAAACAAACCCTTCTGATGAAGTTGTG
GTTTTAGATTTATACAATGAATTCATTCCAGAAATTGATAAAGATATTTTAACTGGATGG
ACTGCTTTACGTTCTGGAGCTGCTTTTGATACATTAACTGCAGACCAACAAAAGAAAATC
GCTCGTTTTAATGAGTTGACTGAACAATTTTTAGCAACTGATAAAGTAGTAGTTGCTAAT
GCTATGTGGAATCTAAACGTACCTACTCGTTTGAAAGCTTGGTTTGATACAATCAACGTT
GCTGGAAAAACATTCCGTTACACTGAAGAAGGGCCAAAACCTTTAGTTGAAGGAAAAAAA
GCCCTACACATCCAGTCAAATGGCGGATTCTACGAAGCACAAGATGCTTCTTCACAATAT
GTAAAAGGGATTTTAAACTTCATTGGTGTTGATCAAGTAGATCAATTATTTATTGAAGGA
ATCGATCATTTCCCTGACCGCGCCGAAGAATTATTAGCTACAGCAATGACTTCTGCAACA
GAACTTGGTAAAACATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)