English site

CDS : I592_02234

CDS Description

CDSI592_02234
Product nameazoreductase
Gene name
ContigASWH01000001
location2229166..2229786
NBRC No.100696
MicrobeEnterococcus gilvus
Current status
>I592_02234 azoreductase
LANVLVVNAHPLSAEDSQTVSVLETFIEAHQASHPEDVFTMLDLYYTDIPEIDGDLLSAW
KSLQKGTDFTELSNVQQEKVRVFNEFTDQFLASEKIVIANALWNLNIPTRLKAWFDTINV
AGKTFKYTAEGPTGLITDKKAVHIQSSGGTYNGQDFSAQYVKGMMNFIGITDFDSIYIEG
ADYDPSKAPEIMNAAKEKAKSLAAQF


>I592_02234 azoreductase
TTGGCAAATGTTTTAGTAGTGAATGCTCACCCGTTGTCCGCAGAAGACTCTCAAACTGTA
AGTGTTTTGGAAACTTTCATCGAGGCACATCAAGCTAGTCATCCAGAAGATGTTTTCACC
ATGTTAGATTTGTATTATACAGATATTCCAGAAATTGACGGCGACTTATTATCCGCTTGG
AAATCGCTTCAAAAGGGAACTGATTTTACAGAATTAAGTAATGTTCAACAAGAAAAAGTT
CGTGTCTTTAATGAATTTACTGATCAATTTTTAGCTAGTGAAAAAATCGTTATCGCCAAC
GCTTTGTGGAATTTAAACATTCCTACACGATTAAAAGCATGGTTTGATACGATCAACGTG
GCAGGTAAAACCTTTAAGTATACTGCAGAAGGTCCTACCGGTTTGATAACTGATAAGAAA
GCTGTTCATATACAATCAAGTGGCGGTACATATAATGGTCAAGATTTCTCAGCGCAATAC
GTTAAGGGAATGATGAATTTTATTGGTATCACTGATTTTGATTCCATTTACATTGAAGGT
GCGGATTATGATCCATCAAAAGCACCTGAGATCATGAATGCGGCAAAAGAAAAAGCCAAA
TCATTGGCTGCGCAGTTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)