English site

CDS : KPR_1296

CDS Description

CDSKPR_1296
Product name
Gene name
ContigFO203501
location1353859..1354497
NBRC No.14438
MicrobeKlebsiella pneumoniae
Current status
>KPR_1296 
MANVLVLKSSINGETSLTNQLINEFLAARQAAGHGDRLIEHDLSAMALPTLDRPLFAALR
GAVDPQPAIREAVALSDQLIAELKASDLLVIGAPMYNLNVPTDLKKWFDLVARARETFRY
TESWPQGRPGADRQQPRRYSPGRNYRRRHALSARGTGADGDPGGGIYLCRRAGQSPAWSR
RRDRQRPGADCPARRSGLSRGEIVLALAAFLF


>KPR_1296 
ATGGCTAACGTTCTGGTTTTAAAATCCAGCATTAATGGCGAAACATCCCTGACCAATCAG
TTGATTAACGAATTTCTCGCGGCGCGCCAGGCGGCGGGACACGGCGATCGGCTCATCGAA
CACGATCTCAGCGCCATGGCGCTGCCAACGCTGGATCGCCCCCTGTTCGCCGCCCTGCGC
GGGGCAGTGGATCCGCAGCCTGCTATCCGCGAGGCGGTCGCCCTCTCCGACCAGCTTATC
GCCGAGTTAAAGGCCAGCGACCTGCTGGTGATCGGCGCGCCGATGTATAACCTCAACGTC
CCGACCGATCTAAAAAAATGGTTCGACCTCGTGGCGCGGGCGCGGGAAACCTTTCGCTAC
ACCGAGAGCTGGCCGCAGGGGCGTCCGGGCGCTGATCGTCAGCAGCCGCGGCGGTATTCA
CCAGGGAGAAACTACCGACGCCGTCACGCCCTATCTGCGCGCGGTACTGGGGCTGATGGG
GATCCAGGAGGTGGAATTTATCTATGCCGAAGGGCTGGACAATCGCCCGCATGGTCGCGA
CGCCGGGATCGCCAGCGCCCGGGCGCAGATTGCCCGGCTCGCCGTTCCGGCCTGAGTCGT
GGAGAAATTGTGCTGGCGCTGGCGGCCTTTTTATTTTAG


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)