English site

CDS : KPR_2860

CDS Description

CDSKPR_2860
Product name
Gene name
ContigFO203501
location2949130..2949735
NBRC No.14438
MicrobeKlebsiella pneumoniae
Current status
>KPR_2860 
MSKVLVLKSSILAGYSQSGQLSDYFVEQWQEKHPGDEITVRDLAANPIPVLDGELVGALR
PSDAPLTPRQQEALALSDELIAELKGNDVIVIAVPMYNFNIPTQLKNYFDLVARAGVTFR
YTEKGPEGLVTGKRAVVVTSRGGIHKDTPTDLVTPYLSTFLGFIGITDVNFVFAEGIAYG
PEVAAKAQSDAKAAIDSVVAA


>KPR_2860 
ATGAGCAAAGTATTAGTTCTGAAATCCAGTATTCTGGCAGGGTACTCACAATCTGGTCAG
CTTTCCGACTATTTTGTTGAACAATGGCAGGAAAAACACCCTGGCGATGAGATCACCGTG
CGTGACCTGGCCGCCAATCCGATCCCGGTTCTGGATGGCGAACTGGTTGGCGCCCTGCGT
CCGAGCGACGCGCCGCTGACTCCGCGTCAGCAGGAAGCGCTGGCCCTTTCCGACGAGCTG
ATCGCCGAACTGAAAGGCAACGATGTGATTGTTATCGCTGTGCCGATGTACAACTTCAAC
ATCCCGACGCAGCTGAAAAACTATTTCGACCTGGTGGCTCGCGCCGGCGTCACCTTCCGC
TACACCGAGAAAGGGCCGGAAGGTCTGGTAACCGGTAAACGCGCGGTCGTCGTTACCAGC
CGCGGCGGTATCCATAAAGATACTCCGACCGACCTGGTCACCCCATACCTGTCCACCTTC
CTCGGCTTCATCGGCATCACCGACGTGAACTTTGTGTTCGCCGAAGGTATCGCTTACGGC
CCGGAAGTCGCGGCCAAAGCGCAGTCTGACGCGAAAGCGGCCATCGACAGCGTGGTTGCA
GCCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)