English site

CDS : Krac_7909

CDS Description

CDSKrac_7909
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigADVG01000002
location1418274..1418906
NBRC No.Not assigned
MicrobeKtedonobacter racemifer
Current status
>Krac_7909 NAD(P)H dehydrogenase (quinone)
MRLLNIESSPRGSRSASIAVTSAFLEAYRQACPGVMVDTLNVWEERLPDFDQEAIGAKYK
GVNKEPMDQTETAVWNKIQELAVRFQQADRIVLGVPMWNFAYPYKLKQLIDLVCQRNMLF
TYDGIEYGPLLKTPRAFVVYVRGGTYAEDSPTPASRFDHQKGYIDFWLKFLGVKEVQTLV
VEGTTWGGKEKGEEAIARGQEEAKKVAADF


>Krac_7909 NAD(P)H dehydrogenase (quinone)
ATGCGTCTACTCAACATCGAATCCTCTCCGCGCGGATCCAGGTCTGCGTCTATCGCCGTC
ACCAGCGCCTTCCTCGAAGCCTACCGTCAGGCTTGTCCTGGGGTCATGGTCGATACCTTG
AATGTCTGGGAGGAAAGGCTGCCGGACTTCGACCAGGAGGCCATCGGGGCGAAGTACAAA
GGTGTGAACAAAGAACCGATGGACCAAACCGAGACCGCCGTCTGGAACAAAATCCAGGAG
TTGGCGGTTCGCTTCCAGCAAGCAGACCGCATCGTGCTCGGTGTGCCCATGTGGAACTTC
GCCTACCCTTACAAACTGAAGCAATTGATTGATCTGGTCTGTCAGCGGAACATGCTCTTT
ACCTATGACGGCATCGAGTATGGCCCTTTGCTGAAAACGCCCCGCGCTTTCGTGGTCTAT
GTGCGAGGCGGGACCTACGCGGAAGATTCGCCGACGCCCGCTTCCCGGTTCGACCATCAG
AAAGGATACATCGATTTCTGGCTGAAGTTTCTCGGGGTCAAGGAAGTTCAGACGCTGGTG
GTGGAAGGCACGACGTGGGGCGGGAAAGAGAAGGGGGAAGAGGCCATCGCGCGTGGTCAG
GAGGAGGCAAAGAAGGTGGCTGCAGATTTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)