English site

CDS : Krad_0234

CDS Description

CDSKrad_0234
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP000750
location2082773..2083405
NBRC No.101839
MicrobeKineococcus radiotolerans
Current status
>Krad_0234 NAD(P)H dehydrogenase (quinone)
MPHLLHLDSSADLATSRSRAVTAAFADTWRARGEEYTVTHRDLHRDPLPHFADAEQHWPA
AARRPGANPPAEQDALTATLHAEVLAADVVLVGAPLYNYTVPSTLKVWLDHLHIPGVLAG
EGSQPLAGRPAVVVSSRGATYDAGSPTEGWDHGVPVLRIVLGNSLGMDVHVVQTSATLAD
RLPEMAALKERGAAEFQAALAAARELARTL


>Krad_0234 NAD(P)H dehydrogenase (quinone)
ATGCCGCACCTGTTGCACCTGGACTCCTCCGCCGACCTCGCGACGTCGCGCTCGCGGGCC
GTCACCGCGGCCTTCGCCGACACCTGGAGGGCCCGGGGGGAGGAGTACACGGTCACCCAC
CGCGACCTGCACCGGGACCCGCTCCCCCACTTCGCCGACGCCGAGCAGCACTGGCCGGCC
GCCGCGCGCCGCCCCGGCGCGAACCCGCCCGCGGAGCAGGACGCGCTCACCGCGACCCTG
CACGCCGAGGTCCTCGCCGCCGACGTCGTCCTCGTGGGGGCGCCGCTCTACAACTACACG
GTGCCCTCGACGCTGAAGGTGTGGCTGGACCACCTCCACATCCCCGGCGTCCTGGCCGGG
GAGGGGTCGCAGCCGCTGGCCGGGCGTCCCGCCGTCGTGGTCAGCAGCCGCGGCGCGACG
TACGACGCGGGCAGCCCCACCGAGGGCTGGGACCACGGGGTCCCGGTGCTGCGGATCGTC
CTGGGCAACTCCCTGGGGATGGACGTCCACGTGGTGCAGACCAGCGCGACGCTGGCCGAC
CGGCTGCCCGAGATGGCCGCGCTGAAGGAGCGCGGCGCGGCGGAGTTCCAGGCCGCGCTG
GCCGCGGCGCGCGAGCTGGCGAGGACCCTCTAG


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)