English site

CDS : MGR_0955

CDS Description

CDSMGR_0955
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCU459003
location609841..610455
NBRC No.15271
MicrobeMagnetospirillum gryphiswaldense
Current status
>MGR_0955 NAD(P)H dehydrogenase (quinone)
MNILHIDSSALGDASVSRQLTAGIVAQLRQGNPAATLTYRDLAISPPDHLSGELMQVVKF
QTIDGLTARQQQELALTNQLVEELLAADTVVIGAPMYNFSVPTQLKAWIDRVAQPGRTFR
YTATGPEGLADGRKVIIASTRGGLYAGTAYETAMDHQEAFLKAFLGFIGISDVQVIRAEG
VAMGPEARDKALAAAQGEIVKLAV


>MGR_0955 NAD(P)H dehydrogenase (quinone)
ATGAACATCCTGCATATTGATTCCAGTGCCCTTGGCGACGCTTCGGTGTCGCGCCAGTTG
ACCGCCGGCATCGTTGCCCAATTGCGCCAGGGCAATCCCGCCGCCACCCTCACCTATCGC
GATCTGGCGATCTCCCCGCCCGACCATCTGAGCGGCGAACTGATGCAGGTGGTCAAGTTC
CAGACCATCGACGGCCTGACCGCGCGCCAGCAGCAGGAACTGGCCCTGACCAACCAACTG
GTCGAGGAATTGCTGGCCGCCGACACGGTGGTGATCGGTGCGCCCATGTACAATTTCAGC
GTTCCCACCCAGTTGAAGGCATGGATCGATCGCGTCGCCCAGCCGGGCCGCACCTTCCGC
TACACCGCCACCGGCCCCGAGGGCCTGGCCGATGGCCGCAAGGTGATCATCGCCTCGACC
CGTGGCGGCCTGTATGCCGGCACCGCTTATGAGACCGCCATGGACCATCAGGAAGCCTTC
CTCAAGGCCTTCTTGGGTTTCATCGGCATCAGCGATGTGCAGGTGATCCGGGCCGAGGGC
GTGGCCATGGGGCCGGAAGCCCGCGACAAGGCCCTGGCAGCCGCCCAGGGTGAAATCGTC
AAACTGGCGGTCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)