English site

CDS : MLP_03100

CDS Description

CDSMLP_03100
Product nameputative FMN-dependent NADH-azoreductase
Gene nameazoR
ContigAP012204
location332338..332997
NBRC No.101784
MicrobeMicrolunatus phosphovorus
Current status
>MLP_03100 putative FMN-dependent NADH-azoreductase
MTTLLHISASPRGQRSESLAIAATFLDEFRSTHPDVTIEHWDLWDGTLPEFGPPAAAAKM
TIFGGAAPEGDEATAWRNARTAFERFDSADYYLFTVPMWNASVPYILKQFIDVISQPGMI
FAFDPVEGYTGLLQNKRAAVIYTGAVYGPDRGPAFGHDFQQPYFEDWLRWAGVGDIHSIA
FRPNLATADPETGRRAAHDRAAEVAHGFLSAAEPALLAG


>MLP_03100 putative FMN-dependent NADH-azoreductase
ATGACCACTCTGCTGCACATCTCCGCCTCCCCCCGCGGCCAGCGCTCCGAGTCCCTCGCC
ATTGCGGCGACGTTCCTCGACGAGTTCCGCTCGACCCATCCCGACGTGACGATTGAGCAC
TGGGACCTCTGGGACGGCACCCTGCCCGAGTTCGGCCCGCCCGCTGCAGCCGCCAAGATG
ACGATCTTCGGCGGCGCCGCCCCCGAGGGCGACGAAGCCACCGCATGGCGCAACGCGCGC
ACCGCGTTCGAGCGCTTCGACTCCGCCGACTACTACCTGTTCACCGTACCGATGTGGAAC
GCGTCGGTGCCCTACATCCTCAAGCAGTTCATCGACGTCATCAGCCAGCCCGGGATGATC
TTCGCCTTCGACCCGGTCGAGGGCTACACCGGCCTGCTGCAGAACAAGCGGGCCGCCGTC
ATCTACACCGGCGCGGTCTACGGCCCCGACCGCGGCCCGGCCTTCGGCCACGACTTCCAG
CAGCCATACTTCGAGGACTGGCTGCGCTGGGCCGGGGTTGGCGACATCCACAGCATCGCG
TTCCGCCCAAACCTGGCCACCGCCGACCCGGAGACCGGACGCCGCGCCGCGCACGACCGC
GCCGCCGAGGTCGCCCACGGATTCCTCTCCGCCGCCGAGCCAGCCCTGCTGGCGGGGTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)