English site

CDS : MLP_48100

CDS Description

CDSMLP_48100
Product nameputative FMN-dependent NADH-azoreductase
Gene nameazoR
ContigAP012204
location5110255..5110908
NBRC No.101784
MicrobeMicrolunatus phosphovorus
Current status
>MLP_48100 putative FMN-dependent NADH-azoreductase
MSLFRIDASIQGDRSFSSALADLVQHEVTAAHPDEPVITRHLGNEPLPADAWQTAILANF
TDPAARTQSQRSAVALAQTLTRELTEADAAVLALPLYNWGVSQHVKTWIDLAIAGAAPGS
RLLDGTPVVLVTTRGGAYGPGTPKEGWDHSIGYLRRILADVWGAELTVIERELTLFGLNP
ALDGLADLAAITKQQAEQAAVEAGRALADRLDARVAA


>MLP_48100 putative FMN-dependent NADH-azoreductase
ATGTCCCTATTCCGGATCGACGCCAGCATCCAGGGCGACCGCTCGTTCAGCAGCGCCTTG
GCCGACCTGGTGCAACACGAGGTCACGGCCGCCCATCCCGACGAGCCAGTGATCACCCGC
CACCTGGGCAATGAGCCGCTGCCTGCGGATGCGTGGCAGACGGCGATCCTCGCGAACTTC
ACCGACCCGGCAGCACGTACGCAGTCTCAGCGCAGCGCGGTCGCCCTGGCTCAGACCCTG
ACCCGCGAACTCACCGAGGCCGACGCCGCCGTGCTGGCACTGCCGCTCTACAACTGGGGC
GTATCCCAGCACGTCAAGACCTGGATCGACCTCGCGATCGCCGGCGCGGCTCCGGGCAGC
CGGCTGCTGGATGGTACGCCGGTCGTGCTGGTCACCACCCGCGGCGGCGCGTACGGTCCG
GGCACTCCGAAGGAGGGCTGGGACCACAGCATCGGCTATCTGCGTCGCATCCTCGCCGAC
GTCTGGGGTGCCGAGTTGACCGTCATCGAGCGCGAGCTGACCCTGTTCGGGCTGAACCCC
GCCCTGGATGGGCTCGCCGACCTGGCTGCGATCACGAAGCAGCAGGCTGAGCAGGCCGCC
GTCGAGGCCGGCCGCGCCCTGGCCGACCGGCTCGACGCACGCGTCGCCGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)