English site

CDS : MPNE_0559

CDS Description

CDSMPNE_0559
Product nameputative NAD(P)H dehydrogenase (quinone)
Gene name
ContigCP002077
location577500..578093
NBRC No.14401
MicrobeMycoplasma pneumoniae
Current status
>MPNE_0559 putative NAD(P)H dehydrogenase (quinone)
MKKVIIIDASVSPSGSYTHLLLERFLATFQAKNKDVELSTWNLNELPVGQISYNTQNAGT
FFSVENSDKYIDALKAAHGVIILAPMTNFNYPATLKNFIDHVFVANKTFKDKYVTKGASS
GMLGNLKVVVLGSQGAPLG*YPWGDHVNSLRGLFGFAGVASFASVIIDGTKLLYKDKSKS
EVVDMFAKQVDAIANEF


>MPNE_0559 putative NAD(P)H dehydrogenase (quinone)
ATGAAGAAGGTAATTATTATTGATGCTTCTGTATCACCTAGTGGTTCTTACACCCATTTA
TTGTTAGAACGCTTTTTAGCTACCTTTCAAGCTAAAAACAAGGACGTAGAGCTCTCCACT
TGGAACCTCAACGAACTACCAGTGGGACAAATTTCCTATAACACCCAAAACGCTGGAACT
TTCTTTTCTGTAGAAAACTCCGATAAGTACATTGATGCGCTCAAAGCAGCGCACGGTGTT
ATTATCTTGGCGCCAATGACCAACTTTAACTACCCCGCAACGTTAAAGAACTTTATTGAC
CATGTCTTTGTGGCAAACAAAACCTTTAAGGATAAGTATGTCACTAAGGGCGCATCATCA
GGAATGTTGGGTAACCTCAAGGTAGTCGTTTTGGGTTCCCAAGGCGCACCGTTAGGTTGA
TACCCATGGGGCGATCATGTCAACAGTCTACGCGGTCTGTTTGGTTTTGCTGGAGTCGCT
AGTTTTGCTAGTGTAATCATTGATGGTACCAAGCTACTTTACAAGGACAAAAGTAAGAGT
GAAGTAGTGGACATGTTCGCTAAACAAGTGGACGCAATTGCTAATGAGTTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)