English site

CDS : Marme_0594

CDS Description

CDSMarme_0594
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigCP002583
location619366..619959
NBRC No.103028
MicrobeMarinomonas mediterranea
Current statusFinished
>Marme_0594 FMN-dependent NADH-azoreductase
MATLLRIDSSASGDASKSRQLTDNFVEQWLAKNPEGQVVTRDVNANPLPHFTSETLGALF
TAEEDRTDEQKAIVSIGDELIEEIENADVVAVSAPMYNFGIPSTLKSYFDYIARAGRTFQ
YTENGPKGLLDKDAYIFAASGSFLADSPVDHQVPHIQTFLGFVGLNVKETFIAGGQAMGE
AGEEAFAKAKEQIAAAV


>Marme_0594 FMN-dependent NADH-azoreductase
ATGGCAACACTACTAAGAATCGACTCAAGTGCATCAGGCGATGCTTCAAAATCACGTCAA
CTAACAGACAACTTCGTTGAGCAATGGCTAGCAAAGAACCCAGAAGGCCAAGTAGTGACT
CGCGACGTTAACGCAAACCCACTGCCACACTTTACAAGTGAGACATTAGGCGCGCTGTTT
ACAGCAGAAGAAGATCGTACCGACGAGCAAAAAGCCATTGTATCAATTGGCGATGAACTC
ATTGAGGAAATTGAAAACGCTGATGTAGTCGCTGTAAGTGCGCCGATGTACAACTTCGGC
ATTCCTTCTACTCTAAAATCATACTTTGATTACATCGCGCGTGCTGGTCGTACATTCCAG
TATACGGAAAACGGTCCAAAAGGCTTATTAGACAAAGATGCATACATATTCGCTGCGAGT
GGCTCTTTTCTAGCAGACTCTCCTGTTGATCACCAAGTTCCACATATCCAAACGTTTCTT
GGGTTTGTAGGACTTAACGTAAAAGAGACCTTCATTGCAGGTGGTCAAGCAATGGGTGAA
GCTGGTGAAGAAGCTTTTGCTAAAGCGAAAGAACAAATCGCTGCTGCCGTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)