English site

CDS : Marme_2372

CDS Description

CDSMarme_2372
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigCP002583
location2608582..2609247
NBRC No.103028
MicrobeMarinomonas mediterranea
Current statusFinished
>Marme_2372 FMN-dependent NADH-azoreductase
MNNLLKVDVSVRKLHHQVEGYRSITRQLGEEFSRLWMNKNNACNVVNRDLALEPPSFITE
AWLAAAFTEEQKRTTEQTTELSESNTYFQEVQQADLIVITSPMYNYGMPAALKAWFDQIM
RVNKTFSFDLSRGDYPIEPILSGKIVVLLSSCGEFGFSEGEERAHLNYLTGHIQLLSKYL
GATDFYEVRSEYQEFADDRYEASLMKAKKDMATVVDKLSSV


>Marme_2372 FMN-dependent NADH-azoreductase
ATGAATAATCTGTTAAAAGTCGACGTCAGTGTTCGCAAGCTTCATCATCAAGTTGAAGGT
TACCGTTCCATTACTCGTCAACTTGGTGAAGAATTTAGTCGTTTATGGATGAATAAAAAT
AATGCATGTAATGTGGTTAATAGGGATCTTGCACTTGAACCACCATCGTTTATCACTGAA
GCGTGGTTAGCAGCGGCATTCACAGAAGAGCAAAAGCGAACGACCGAGCAAACGACGGAA
TTAAGCGAGTCCAATACGTACTTTCAGGAAGTTCAGCAGGCCGATCTCATCGTAATTACT
TCCCCTATGTATAACTATGGAATGCCTGCCGCCTTGAAAGCCTGGTTTGACCAAATAATG
CGAGTGAACAAAACATTCTCGTTTGATCTGTCGAGAGGCGATTATCCTATTGAACCTATC
TTGTCGGGAAAAATCGTTGTTCTTCTTTCATCGTGCGGGGAATTTGGCTTTAGCGAAGGG
GAAGAACGAGCACACCTTAACTACCTCACTGGTCATATTCAACTGCTTAGCAAATACCTT
GGGGCCACAGATTTCTATGAAGTGCGTTCTGAATATCAAGAGTTCGCCGATGATCGATAC
GAAGCCTCGCTGATGAAAGCCAAAAAGGATATGGCAACGGTAGTCGATAAACTTTCGAGT
GTTTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)