English site

CDS : Myrod_0247

CDS Description

CDSMyrod_0247
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigCM001437
location298359..298952
NBRC No.14945
MicrobeMyroides odoratus
Current statusImproved High-Quality Draft
>Myrod_0247 FMN-dependent NADH-azoreductase
MKTILHLTSSARGEQSHSTNLGLAIIKRLEEQEQVIAIETWDLVQNPPPLYSSEMIQSFY
VAPDQPNYDSIPTLAYANRVVDKVKEADIIVISTPTYNFTVSAHLKAWVDQLVRVGVTYT
YDEKGSRVGLITQKKVYLAIASGGIQPAGIVQDYLADYLKAVLKAYVGITAVVTYRIEGT
AFPNFSPDYAGIVENFQ


>Myrod_0247 FMN-dependent NADH-azoreductase
ATGAAGACCATTTTACACCTTACCTCAAGTGCAAGAGGAGAACAGTCGCATAGCACGAAC
TTAGGATTAGCTATTATCAAGCGTTTAGAAGAACAAGAACAAGTGATTGCCATAGAAACG
TGGGATTTGGTGCAGAACCCACCACCTTTATACAGCAGTGAGATGATTCAGAGCTTCTAT
GTTGCACCAGACCAACCCAACTATGATTCTATTCCAACGTTAGCCTATGCCAATAGAGTT
GTTGACAAAGTGAAGGAAGCAGATATCATCGTAATCAGTACACCGACTTATAATTTTACT
GTTTCGGCTCATTTAAAAGCATGGGTGGATCAACTGGTTCGCGTGGGTGTAACGTATACG
TATGACGAAAAAGGGAGTCGAGTAGGACTGATTACGCAGAAAAAAGTCTATTTGGCTATT
GCTTCCGGTGGAATACAACCAGCGGGAATCGTTCAGGATTATTTAGCGGATTACTTGAAA
GCTGTTTTGAAGGCCTATGTTGGGATTACAGCCGTAGTGACTTATCGAATAGAAGGAACC
GCCTTTCCTAATTTTTCACCTGATTATGCAGGAATCGTAGAAAATTTTCAATAG


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)