English site

CDS : Namu_1846

CDS Description

CDSNamu_1846
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP001737
location2030905..2031531
NBRC No.105858
MicrobeNakamurella multipartita
Current status
>Namu_1846 NAD(P)H dehydrogenase (quinone)
MTTLLHISASPRGEQSESLAIAATFLAAYRQTHPDNDIQTWDLWDGSLPAFGPAAAAAKM
AVFAGVEPAGEPAAAWRAAGAAFERFAAADEYLFSVPMWNAGIPYILKQFIDVVSQPGLV
FGFDPELGYTGLLAGRKAAVIYTSAVYGRGRPPSFGSDFQSPYVRDWLNWAGVADVCEIE
FRPDLAVADAASGRQAAHAAARDAGKAF


>Namu_1846 NAD(P)H dehydrogenase (quinone)
ATGACCACACTGCTGCACATCAGCGCATCGCCACGGGGCGAGCAGTCCGAATCGCTGGCG
ATCGCCGCCACCTTCCTGGCGGCCTACCGGCAGACCCATCCGGACAACGACATTCAGACC
TGGGATCTGTGGGACGGCTCGCTGCCGGCATTCGGACCGGCGGCGGCCGCGGCCAAAATG
GCGGTGTTCGCGGGGGTGGAGCCGGCGGGGGAGCCGGCGGCCGCCTGGCGCGCGGCCGGC
GCCGCGTTCGAGCGCTTCGCCGCCGCCGACGAGTACCTGTTCAGCGTGCCGATGTGGAAC
GCCGGCATTCCGTACATCCTCAAGCAGTTCATCGACGTGGTCAGCCAACCGGGTCTGGTC
TTCGGATTCGATCCCGAGCTCGGGTACACCGGCCTGCTGGCCGGCCGCAAGGCCGCGGTC
ATCTACACCAGCGCCGTCTACGGCCGGGGCCGGCCGCCGTCCTTCGGGTCGGACTTCCAG
TCCCCGTACGTCCGGGACTGGTTGAACTGGGCCGGCGTGGCGGACGTCTGCGAGATCGAG
TTCCGACCTGACCTGGCCGTCGCCGACGCCGCCTCCGGGCGGCAGGCCGCGCACGCCGCG
GCCCGGGACGCCGGCAAGGCGTTCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)