English site

CDS : Ndas_5035

CDS Description

CDSNdas_5035
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP002041
location177215..177916
NBRC No.14626
MicrobeNocardiopsis dassonvillei
Current status
>Ndas_5035 NAD(P)H dehydrogenase (quinone)
MTSLLHLDSSHSDHSVSRYLTGLFAREWRRLHGDGGYRYRDLAAEPVPLVTATYCSFAQR
VERRGTLPLTAVTAMAESPSEEREWAGTLPLIEEVLDADTLLIGLPMYNYTVPASLKAWI
DRITFPGAFKDSRTGESLLRDARAVVVAARGGGYGPGSPKEAFDFQTPYMRMYLEGLGIA
GENVHVVHAEMTRASDVPELAEFQDMAARSLAEAEERVTRLPALLAPREPAVR


>Ndas_5035 NAD(P)H dehydrogenase (quinone)
ATGACGTCTTTGCTGCACCTGGACTCCAGCCACTCGGACCACTCGGTGAGCAGGTACCTC
ACCGGCCTGTTCGCCAGGGAGTGGCGACGGCTGCACGGGGACGGGGGATACCGCTACCGG
GACCTTGCCGCCGAACCGGTGCCGCTGGTCACCGCCACCTACTGCTCCTTCGCCCAGCGG
GTGGAGAGGCGGGGCACCCTGCCGCTGACGGCGGTGACGGCCATGGCCGAGTCGCCGTCC
GAGGAGCGGGAGTGGGCGGGAACCCTGCCCCTGATCGAGGAGGTCCTGGACGCGGACACC
CTGCTGATCGGCCTCCCGATGTACAACTACACCGTCCCGGCCTCGCTCAAGGCGTGGATC
GACAGGATCACCTTCCCCGGGGCCTTCAAGGACTCCCGCACCGGGGAGTCGCTGCTGCGC
GACGCCCGGGCCGTGGTGGTCGCCGCGCGCGGAGGGGGCTACGGGCCGGGTTCGCCCAAG
GAGGCGTTCGACTTCCAGACGCCCTACATGCGCATGTACCTGGAGGGCCTGGGCATCGCC
GGCGAGAACGTGCACGTCGTCCACGCCGAGATGACCAGGGCCTCGGACGTCCCCGAGCTG
GCGGAGTTCCAGGACATGGCCGCGCGCTCCCTGGCGGAGGCGGAGGAGCGGGTGACCCGC
CTGCCCGCGCTGCTGGCGCCGCGCGAGCCCGCGGTGCGCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)