English site

CDS : Niako_2531

CDS Description

CDSNiako_2531
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigCP003178
location3141160..3141768
NBRC No.106392
MicrobeNiastella koreensis
Current statusFinished
>Niako_2531 FMN-dependent NADH-azoreductase
MKKILNIVSSAKGNNSFSIKLSNAIIDKLLAAYPGSQVKTHDLTANPLPHLHENQLNAFF
TPEEKRTDSHKQLVDYSDQAIQDLKDADIVVIGVPFYNFNIPSALKAWVDHIVRGGITFK
YENGAPQGLVTNKKVYLAMASGGVYSDGPMKQYDFAEPFLRFILSFIGLNDITTFRVEGT
AYPDLADAAFPKAVEAVNEYAF


>Niako_2531 FMN-dependent NADH-azoreductase
ATGAAAAAGATACTGAACATAGTGTCGAGCGCTAAAGGAAACAACTCCTTCAGCATTAAA
TTATCTAACGCTATTATTGACAAATTGTTAGCGGCTTACCCCGGCAGCCAGGTAAAAACT
CACGACCTGACCGCCAATCCGCTGCCGCATTTACACGAGAACCAGTTGAATGCGTTTTTT
ACTCCGGAGGAAAAACGTACCGACAGTCATAAACAACTGGTTGATTACTCTGACCAGGCT
ATCCAGGACCTGAAAGATGCCGATATTGTGGTGATTGGTGTGCCTTTTTACAATTTCAAT
ATTCCTTCTGCCTTAAAAGCATGGGTAGATCATATTGTACGGGGTGGCATTACCTTTAAA
TATGAAAATGGAGCGCCACAAGGGCTGGTTACCAATAAAAAAGTATACCTGGCCATGGCA
AGCGGCGGAGTTTATTCGGATGGCCCCATGAAACAGTATGATTTTGCAGAACCATTTCTG
CGATTCATCCTGTCGTTTATCGGGTTGAATGATATCACCACTTTCCGGGTTGAAGGAACG
GCGTACCCTGATCTGGCAGATGCGGCGTTTCCCAAAGCTGTGGAAGCGGTGAATGAGTAT
GCCTTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)