English site

CDS : PAV_11c01530

CDS Description

CDSPAV_11c01530
Product nameFMN-dependent NADH-azoreductase AzoR
Gene nameazoR
ContigAMBZ01000011
location95346..95984
NBRC No.3343
MicrobePaenibacillus alvei
Current status
>PAV_11c01530 FMN-dependent NADH-azoreductase AzoR
MKKVLVINSNPKPTELSFGLRLGEHYLAALQAEANVQVERVNLYEENIPLIDGTVLDAWG
KAGAGEALSAEQTNTLGRMNEILEQFIAADVVVFITPMWNLSYPPLLKAYIDNVIIAGRT
FKYTAEGPQGLLGGKKVVHIEARGGVYSEGPTAGLRFADTYLQAIMGFIGISDYENIVVE
GMAATPDRAEEILASAKQRAEQSAKSLAASMK


>PAV_11c01530 FMN-dependent NADH-azoreductase AzoR
ATGAAAAAGGTACTTGTTATTAACTCCAATCCAAAACCAACTGAATTGTCTTTCGGTCTT
CGTCTTGGTGAGCACTATTTGGCTGCTCTTCAAGCAGAAGCTAATGTTCAAGTCGAACGC
GTAAATTTGTATGAAGAAAACATTCCATTGATCGACGGCACAGTATTGGATGCTTGGGGT
AAAGCTGGAGCAGGCGAAGCTTTGTCTGCTGAACAAACAAACACATTGGGCCGCATGAAT
GAGATTTTGGAGCAATTTATTGCAGCAGATGTTGTTGTATTCATTACTCCAATGTGGAAC
TTGAGCTATCCGCCGCTTCTTAAAGCATATATCGATAACGTGATTATCGCTGGCCGTACA
TTCAAGTACACAGCAGAAGGCCCACAAGGCTTGCTCGGAGGGAAGAAAGTGGTACACATC
GAAGCGCGCGGCGGCGTATACTCCGAAGGTCCTACAGCTGGTCTTCGCTTCGCAGACACT
TATCTGCAAGCGATTATGGGCTTCATCGGCATTAGCGATTACGAAAATATCGTTGTAGAA
GGCATGGCTGCGACACCTGATCGTGCAGAAGAAATTCTTGCTTCCGCGAAGCAACGTGCT
GAGCAAAGCGCTAAAAGCTTGGCAGCATCTATGAAATAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)