English site

CDS : PPT_11105

CDS Description

CDSPPT_11105
Product nameazoreductase
Gene name
ContigNZ_GL905390
location2349669..2350295
NBRC No.15309
MicrobePaenibacillus polymyxa
Current status
>PPT_11105 azoreductase
MSKVLFVKANDRTAEESATVKLYNAFVESYKFSHPSDEITELDLFSVELPYLNANMINGT
FKSARGMELNAEEARLANIANGYLDQFLAADKVVFAFPLWNMTIPAVLHTYIDYLNQAGK
TFKYTAEGPVGLVTDTKVALLNARGGVYSEGPAAAAEMSLNFMSNILTFFGVKDIVKVVL
EGHNQAPDQAQEIVASAVQRAVDAAKSF


>PPT_11105 azoreductase
ATGTCTAAAGTATTATTTGTCAAAGCTAATGATCGTACAGCTGAAGAATCTGCAACAGTT
AAATTGTATAACGCATTCGTGGAAAGCTACAAGTTTTCCCACCCATCTGATGAAATCACT
GAGCTGGACCTGTTCTCCGTCGAGCTTCCTTATCTGAACGCTAACATGATCAACGGCACG
TTCAAATCCGCAAGAGGCATGGAGCTGAACGCAGAAGAAGCTCGCCTGGCAAACATCGCT
AATGGTTATCTGGATCAATTCTTGGCAGCAGACAAAGTCGTATTTGCTTTCCCGCTCTGG
AATATGACGATTCCAGCTGTACTGCACACATACATTGACTACCTGAACCAAGCTGGTAAA
ACATTCAAATACACTGCTGAAGGTCCTGTAGGTCTTGTAACTGACACTAAAGTAGCCCTG
TTGAATGCAAGAGGCGGCGTTTATTCCGAAGGGCCTGCTGCTGCTGCTGAGATGTCTTTG
AACTTCATGAGCAACATCTTAACCTTCTTCGGTGTTAAAGACATTGTGAAGGTTGTACTG
GAAGGACATAACCAAGCTCCTGACCAAGCACAAGAGATCGTTGCTTCTGCCGTACAACGT
GCAGTAGACGCAGCAAAATCGTTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)