English site

CDS : PSTAB_1543

CDS Description

CDSPSTAB_1543
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP002881
location1598531..1599250
NBRC No.14165
MicrobePseudomonas stutzeri
Current status
>PSTAB_1543 NAD(P)H dehydrogenase (quinone)
MTHLLHLDASARPGLAGKDEHGSHSRNLSQRFVSQWLARRPQDGVTYRDIGQNPPSFVSH
DWIASAFTPEERREPWMKDALAESDRLVDELLAADVLIIGTPLYNFGMPAALKAWIDQVV
RLNRTVGLDESNPLDPYVPMLADRERHAVILTARGGVGFGPGGAMAHMNHLEPNLATALG
FIGITRIHQIAIEGQEVGGELMANSVAEALRQVDALVTELQSTIAAPRPRVSQRQAEAS


>PSTAB_1543 NAD(P)H dehydrogenase (quinone)
ATGACGCACCTTCTGCACCTCGACGCCAGCGCCCGCCCCGGCCTTGCCGGCAAGGACGAA
CACGGTTCTCACAGCCGCAACCTCAGCCAGCGCTTCGTCAGCCAATGGTTGGCGCGTCGC
CCGCAGGATGGCGTGACCTACCGGGACATCGGCCAGAACCCACCCTCCTTCGTCAGCCAT
GATTGGATCGCCTCGGCCTTCACGCCGGAGGAGCGCCGGGAGCCGTGGATGAAGGACGCG
TTGGCCGAAAGCGACAGGCTGGTCGACGAACTGTTGGCCGCCGATGTGCTGATCATCGGC
ACGCCGCTCTACAACTTCGGCATGCCGGCGGCGCTCAAGGCGTGGATCGATCAGGTGGTG
CGCCTGAACCGCACGGTCGGGCTGGACGAGAGCAACCCGCTTGATCCCTACGTGCCCATG
TTGGCGGATCGGGAGCGGCACGCGGTCATCCTCACCGCCCGGGGTGGCGTAGGCTTCGGC
CCCGGAGGGGCGATGGCGCATATGAACCATCTGGAGCCGAACCTGGCGACCGCGCTGGGG
TTCATCGGCATCACCCGCATCCACCAGATCGCCATCGAGGGTCAGGAGGTGGGGGGCGAG
CTGATGGCCAATTCGGTAGCCGAGGCGCTGCGTCAGGTGGATGCGCTGGTGACGGAGCTG
CAGAGCACCATCGCCGCGCCACGCCCCCGCGTCAGCCAGCGCCAGGCCGAAGCGAGCTAG


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)