English site

CDS : PpeoK3_010100001385

CDS Description

CDSPpeoK3_010100001385
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigNZ_AGFX01000009
location73172..73828
NBRC No.15541
MicrobePaenibacillus peoriae
Current status
>PpeoK3_010100001385 NAD(P)H dehydrogenase (quinone)
LKTVLYITAHPLAQHASYSLTVGKEFIDTYREAHPEEEVIHLDLFQMDVPPVDADILNAR
YKLFQWRKADSNTPFDQLLSDAERIKLAQIDELCDQFIAADKYIFASPMWNLTIPHVLLN
YTNCLVIPGKTYRYTETGPVGLLTGKKAIHIQASGGVYSEGPASSLECGNSYLRTIMQFI
GVTDVQSIFIEGMAEMPDRAEAIKEEAIAKAREAAKQF


>PpeoK3_010100001385 NAD(P)H dehydrogenase (quinone)
TTGAAAACCGTGTTATATATTACTGCTCATCCACTTGCTCAACATGCTTCGTACAGCTTG
ACTGTCGGTAAGGAGTTTATCGATACCTATCGTGAAGCGCACCCAGAGGAAGAAGTCATC
CATCTCGACTTGTTCCAAATGGATGTTCCGCCAGTAGATGCCGATATACTTAACGCAAGA
TATAAACTATTTCAATGGAGAAAAGCTGACTCCAACACTCCGTTCGACCAGTTGCTGTCT
GATGCCGAGCGAATAAAGCTTGCCCAGATAGATGAACTCTGTGATCAATTCATTGCAGCG
GATAAATATATCTTTGCTTCGCCGATGTGGAACCTCACGATTCCGCATGTGTTGCTTAAT
TATACGAATTGCTTAGTTATCCCAGGCAAGACATACCGTTATACGGAGACCGGCCCTGTG
GGACTTCTAACTGGCAAGAAGGCGATTCATATCCAAGCTAGCGGCGGAGTCTACTCAGAA
GGTCCTGCCTCGTCCTTGGAGTGTGGGAACAGTTACTTACGCACAATCATGCAGTTCATC
GGAGTCACTGATGTCCAGAGCATTTTCATTGAGGGAATGGCCGAAATGCCTGATCGAGCT
GAAGCCATTAAGGAAGAGGCTATCGCGAAAGCAAGAGAAGCTGCAAAACAATTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)