English site

CDS : PpeoK3_010100001820

CDS Description

CDSPpeoK3_010100001820
Product nameazoreductase
Gene name
ContigNZ_AGFX01000009
location173970..174608
NBRC No.15541
MicrobePaenibacillus peoriae
Current status
>PpeoK3_010100001820 azoreductase
MTKVLFITAHPLEESTSYSLAVGEAFIESYKEANPEDEIVNIDLYKEYIPHIDAHVFSGW
GKLRSGSEFNQLSSDEQEKVKRLAELSDQFIEADKYIFVTPFWNFSYPPVMKAYIDAVSV
AGKSFRYSEQGQPIGLLTDKKAIHIQARGGFYSESPANELEMGHRHLQVIMNFFGVPSFE
GLFVEGHNKAKDKAQEIKENAIARAKVLAKTF


>PpeoK3_010100001820 azoreductase
ATGACAAAAGTACTTTTTATTACAGCACACCCTCTAGAGGAGTCCACATCTTATAGCCTG
GCTGTGGGTGAAGCATTTATCGAATCTTACAAGGAAGCTAATCCGGAAGATGAAATTGTG
AACATTGATTTGTATAAAGAATATATTCCTCACATTGATGCGCATGTTTTTAGTGGCTGG
GGAAAACTCCGCTCCGGAAGTGAATTTAATCAACTTTCAAGCGATGAGCAAGAGAAAGTA
AAGCGTCTCGCAGAACTGTCTGACCAATTTATTGAAGCAGACAAATATATATTCGTTACT
CCTTTCTGGAATTTTTCATATCCTCCAGTGATGAAAGCTTATATTGATGCTGTTTCTGTG
GCGGGTAAATCTTTCCGTTACTCAGAACAGGGTCAACCCATTGGATTACTGACTGATAAA
AAAGCAATTCATATTCAGGCACGGGGTGGTTTTTACTCCGAGAGTCCTGCGAATGAACTT
GAAATGGGGCATCGTCACCTTCAAGTCATCATGAATTTCTTCGGTGTACCTTCATTCGAA
GGTCTGTTTGTTGAAGGTCATAATAAAGCTAAGGACAAAGCACAAGAGATCAAAGAAAAT
GCCATTGCGAGAGCTAAAGTTCTTGCCAAAACATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)