English site

CDS : PpeoK3_010100007746

CDS Description

CDSPpeoK3_010100007746
Product nameazoreductase
Gene name
ContigNZ_AGFX01000012
location333596..334222
NBRC No.15541
MicrobePaenibacillus peoriae
Current status
>PpeoK3_010100007746 azoreductase
MSKVLFVKANDRTAEESATVKLYNAFVESYKSSHPSDEITELDLFSVELPYLNANMINGT
FKSARGMELNAEEARLANIANGYLDQFLAADKVVFAFPLWNMTIPAVLHTYIDYLNQAGK
TFKYTAEGPVGLVTDKKVVLLNARGGVYSEGPAAAAEMSLNYMSNILSFFGVKDIVKVVL
EGHNQAPDQAQDIVASAVQGAVEAAKSF


>PpeoK3_010100007746 azoreductase
ATGTCTAAAGTATTGTTTGTCAAAGCTAATGATCGTACAGCCGAAGAATCTGCAACGGTT
AAATTGTATAACGCCTTCGTGGAAAGCTACAAGTCTTCCCACCCGTCTGATGAAATCACT
GAGCTGGACCTGTTCTCTGTCGAGCTTCCTTATTTGAACGCTAACATGATTAACGGTACG
TTCAAATCCGCTAGAGGCATGGAATTGAACGCTGAAGAAGCTCGCCTGGCCAACATTGCC
AATGGCTACCTGGATCAATTCCTGGCAGCAGACAAAGTGGTATTTGCTTTCCCGCTCTGG
AACATGACAATCCCTGCAGTATTGCATACGTACATTGACTACCTGAACCAAGCTGGCAAA
ACATTCAAATACACTGCTGAAGGTCCTGTTGGTCTCGTAACTGACAAAAAAGTAGTCCTG
TTGAACGCAAGAGGCGGCGTATATTCCGAAGGACCGGCTGCTGCTGCTGAAATGTCTTTG
AACTACATGAGCAACATCTTATCCTTCTTCGGTGTAAAAGACATCGTGAAGGTTGTACTG
GAAGGACATAACCAAGCTCCAGATCAAGCACAAGACATCGTAGCATCTGCTGTTCAAGGT
GCAGTAGAAGCAGCAAAATCGTTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)