English site

CDS : RAM_30070

CDS Description

CDSRAM_30070
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigCP002896
location6504349..6504990
NBRC No.13415
MicrobeAmycolatopsis mediterranei
Current status
>RAM_30070 FMN-dependent NADH-azoreductase
MAHLLHIDSSIQGERSVSRRLSARAAAAWRAAHPDGTVAYRDLGAHPLPHIDAASGLAGM
VPPDQHTPEQAAAWARTTELVAEIKAADTVLLGLPLYNFGAPSSVKTWVDHLIAPGLSVD
HATQTGLLGGREFIVLASRGGGYGEGTPREGWDHAEQWLPHGVSLTGLEPRFITAELTLA
HVNPAMAELIPLADASLATAERIIDELWVPAHV


>RAM_30070 FMN-dependent NADH-azoreductase
ATGGCGCATCTCCTCCACATCGACTCGAGCATCCAGGGCGAGCGTTCGGTGAGCCGCCGG
CTCAGCGCGCGGGCCGCGGCGGCGTGGCGCGCCGCGCACCCGGACGGCACGGTCGCCTAC
CGCGACCTCGGCGCGCACCCGCTGCCCCACATCGACGCGGCGAGCGGCCTGGCCGGGATG
GTGCCGCCGGACCAGCACACGCCCGAGCAGGCGGCCGCGTGGGCGCGGACCACCGAGCTG
GTCGCCGAGATCAAGGCGGCCGACACCGTGCTGCTGGGCCTGCCGCTCTACAACTTCGGC
GCGCCGAGCAGCGTGAAGACCTGGGTCGACCACCTCATCGCGCCGGGCCTCTCGGTCGAC
CACGCAACCCAGACCGGCCTCCTCGGCGGCCGCGAGTTCATCGTGCTGGCGTCCCGGGGC
GGCGGGTACGGCGAGGGCACGCCCCGCGAAGGCTGGGACCACGCCGAGCAGTGGCTGCCC
CACGGCGTCTCGCTGACCGGCCTGGAGCCCCGCTTCATCACGGCGGAACTCACGCTGGCC
CACGTGAACCCGGCGATGGCCGAGCTCATCCCGCTCGCGGACGCGAGCCTGGCCACCGCG
GAGCGCATCATCGACGAGCTGTGGGTCCCGGCGCACGTCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)