English site

CDS : RER_13480

CDS Description

CDSRER_13480
Product nameputative azoreductase
Gene nameazoR
ContigAP008957
location1485355..1485999
NBRC No.100887
MicrobeRhodococcus erythropolis
Current status
>RER_13480 putative azoreductase
DERVHARLHHEIRQLAHPLLGGPVEQRVRRSVAHPPEDVVGADDRTRIAARVRGARVDLR
VHAGQDVRREVGARRNPSVGGTAQRTQQARPADTEPDPDRMRRDRPGMHAGEAVVLTFGI
HGTLTGPHEANHLDRLLDRRRRLAGRANVATHRPDRIPEGARTQRQFEPAARHHVETGRG
LRHHRGRTQRQARDVGKHAHPLGPGEQGAHQREGV


>RER_13480 putative azoreductase
GACGAACGTGTCCATGCCCGTCTCCACCACGAGATCCGTCAGTTGGCTCACCCATTGCTC
GGTGGTCCCGTGGAACAGCGTGTCCGACGGAGTGTCGCCCACCCGCCCGAAGATGTTGTA
GGCGCGGACGATCGAACTCGGATCGCGGCCCGCGTCCGCGGCGCCCGCGTCGATCTTCGC
GTGCATGCCGGGCAGGACGTCCGGCGGGAAGTAGGAGCTCGACGGAACCCATCCGTCGGC
GGAACGGCCCAGCGCACGCAGCAAGCGCGGCCCGCCGACACCGAGCCAGATCCCGATCGG
ATGCGCCGGGACAGGCCCGGGATGCACGCCGGCGAGGCGGTAGTGCTCACCTTCGGAATA
CACGGCACGCTCACCGGACCACATGAGGCGAATCACCTCGACCGCCTCCTCGACCGCCGT
CGCCGCCTGGCCGGGCGTGCGAACGTCGCCACCCATCGCCCCGATCGCATCCCAGAAGGC
GCCCGCACCCAACGCCAGTTCGAACCGGCCGCCCGACATCACGTCGAGACTGGCCGCGGC
CTTCGCCATCACCGCGGGCGGACGCAGCGGCAGGCACGCGACGTCGGGAAACACGCGCAC
CCGCTCGGTCCGGGCGAGCAGGGTGCCCATCAGCGAGAAGGAGTC


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)