English site

CDS : Rmet_1590

CDS Description

CDSRmet_1590
Product nameFMN-dependent NADH-azoreductase (FMN-dependent NADH-azo compound oxidoreductase) (Azo-dye reductase)
Gene nameazoR1
ContigCP000352
location1714908..1715531
NBRC No.102507
MicrobeCupriavidus metallidurans
Current status
>Rmet_1590 FMN-dependent NADH-azoreductase (FMN-dependent NADH-azo compound oxidoreductase) (Azo-dye reductase)
MNILQIDSSVLGDNSVSRSLTASIVADLVAKNPGAKVTVRDLDKEAPAHLGNHLLPVLGG
PKDGLNAVQQAELERTETFLAEFMAADVLVIGVPQYNFSIPSQLKAWIDRIAQAGRTFRY
TANGPEGLAVGKRVIVVSSRGGVRQDANTLDLHEVTIDAVLRFLGITDISIVRAHGLAMG
PDAREAGLTTARSQIAALNDAALRAAA


>Rmet_1590 FMN-dependent NADH-azoreductase (FMN-dependent NADH-azo compound oxidoreductase) (Azo-dye reductase)
ATGAACATCCTGCAAATCGATTCGAGCGTACTGGGCGACAACTCCGTATCGCGTTCCCTG
ACCGCCAGCATCGTGGCCGACCTCGTTGCCAAGAACCCAGGCGCCAAGGTAACCGTGCGC
GATCTGGACAAGGAAGCCCCCGCCCACCTCGGCAACCACCTGCTGCCGGTGCTGGGTGGC
CCGAAGGACGGCCTGAACGCCGTGCAGCAAGCCGAACTCGAGCGCACTGAAACGTTCCTG
GCCGAATTCATGGCTGCCGATGTGCTGGTGATTGGCGTGCCGCAGTACAACTTCAGCATC
CCGAGCCAGCTCAAGGCCTGGATCGACCGCATCGCGCAAGCCGGCCGCACCTTCCGCTAC
ACCGCCAACGGCCCTGAAGGCCTGGCAGTCGGCAAGCGCGTGATCGTGGTGTCGTCGCGA
GGCGGCGTGCGTCAGGACGCCAACACGCTGGACCTGCACGAAGTCACCATCGATGCGGTG
TTGCGCTTCCTCGGTATCACCGACATCAGCATCGTCCGCGCTCACGGTCTGGCCATGGGC
CCCGACGCGCGCGAAGCCGGTCTCACGACCGCCCGCTCGCAGATTGCCGCGCTCAACGAC
GCCGCGCTGCGCGCCGCTGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)