English site

CDS : SCAT_3080

CDS Description

CDSSCAT_3080
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigFQ859185
location3240360..3241013
NBRC No.14057
MicrobeStreptomyces cattleya
Current status
>SCAT_3080 FMN-dependent NADH-azoreductase
MATLLHIDSSLFPLEGSTSRQVTATFRKEWEAQHPEGKVIYRDLAAEPVPHLELHGTLAG
FAPAAEHTPEQAAAFALRDQLARELEEADAVLIGAPMYNFTIPSTLKAWLDHVILMGRTV
GEQRSAAGKPTVVVASRGGGYGPGTPRESFEFVTTYLDKVLAESFGLKVDYIVPELTLAR
SNPAMADLVELADASKAKAHEEAAAKAKELAVRLAAK


>SCAT_3080 FMN-dependent NADH-azoreductase
ATGGCCACGCTGCTGCACATCGACTCGTCGCTCTTCCCGCTGGAGGGCTCCACCTCCCGC
CAGGTGACCGCCACCTTCCGCAAGGAATGGGAGGCCCAGCACCCGGAGGGCAAGGTGATC
TACCGCGACCTCGCCGCCGAGCCCGTCCCCCACCTGGAGCTGCACGGCACCCTGGCCGGC
TTCGCCCCGGCCGCCGAGCACACCCCGGAGCAGGCCGCCGCCTTCGCCCTGCGCGACCAG
CTCGCCCGTGAGCTGGAGGAGGCCGACGCCGTGCTGATCGGCGCGCCGATGTACAACTTC
ACCATCCCCTCCACCCTCAAGGCGTGGCTGGACCACGTGATCCTGATGGGCCGCACCGTC
GGCGAGCAGCGCTCCGCGGCCGGGAAGCCGACCGTCGTGGTGGCCAGCCGGGGCGGCGGC
TACGGCCCGGGCACCCCGCGCGAGTCCTTCGAGTTCGTCACCACCTACCTCGACAAGGTG
CTCGCCGAGAGCTTCGGCCTGAAGGTCGACTACATCGTCCCGGAGCTGACCCTGGCCCGC
AGCAACCCGGCCATGGCCGACCTGGTCGAGCTGGCCGACGCCTCCAAGGCCAAGGCCCAC
GAGGAGGCCGCCGCCAAGGCCAAGGAGCTGGCCGTCCGGCTGGCCGCCAAGTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)