English site

CDS : SLG_06410

CDS Description

CDSSLG_06410
Product nameFMN-dependent NADH-azoreductase
Gene nameazoR
ContigAP012222
location664786..665367
NBRC No.103272
MicrobeSphingobium sp.
Current status
>SLG_06410 FMN-dependent NADH-azoreductase
MNLLHIDSSIQGDASLSRAMSAAVVSRLRALHPDVTVTYRDLAEHPLPHMTLPGFATPEA
QAVLEEFLAADVVVIGVPMYNFTISSQLKAWLDHIAIAGKTFRYTEQGPVGLAGDKRVIL
ALSRGGFYSEGPAASMEHAETYLRAILGFMGITAPELVLAEGAALGPDQREAALAGGLEA
ANRIEPTPAESVA


>SLG_06410 FMN-dependent NADH-azoreductase
ATGAATCTGCTTCACATCGATTCCAGCATCCAGGGGGATGCGTCCCTCAGCCGCGCGATG
TCGGCCGCTGTCGTTTCCCGCCTGCGGGCTCTCCATCCCGATGTCACGGTCACGTATCGC
GACCTCGCCGAGCATCCCCTGCCGCACATGACGCTGCCCGGCTTCGCCACGCCGGAGGCG
CAGGCGGTGCTGGAGGAATTTCTCGCGGCCGATGTCGTGGTGATCGGTGTGCCCATGTAT
AATTTCACGATTTCGAGCCAGCTCAAGGCCTGGCTGGATCATATCGCCATTGCCGGCAAG
ACGTTCCGCTATACCGAGCAGGGCCCGGTCGGCCTGGCGGGCGACAAGCGCGTCATCCTC
GCCTTGTCGCGCGGCGGCTTCTATTCGGAAGGACCGGCCGCTTCCATGGAGCATGCCGAG
ACCTATCTGCGCGCGATCCTGGGCTTCATGGGCATCACGGCGCCCGAGCTCGTGCTGGCC
GAAGGCGCGGCACTGGGCCCGGACCAGCGGGAAGCTGCGCTCGCCGGGGGTCTGGAAGCC
GCGAACAGGATCGAGCCGACACCCGCCGAGTCCGTGGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)