English site

CDS : Snas_2531

CDS Description

CDSSnas_2531
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP001778
location2671540..2672172
NBRC No.102104
MicrobeStackebrandtia nassauensis
Current status
>Snas_2531 NAD(P)H dehydrogenase (quinone)
MSVLLHVDSSINGDNSHSRKVTATFAKEWQAANPQGRYIYRDVAADPIPHIDAVTYGAIN
SPESEHTPEQAEAFGPAKHIIDEVVAADTILLGVPMYNFSVPSHLKAWMDRIAIGRFFAD
DDGKSELSDKKFVIATSRGGSYAPGTPRHHFDHQEPYLERFFEFLGAKDLTFLHTEMALS
HVVPALAQFKHIYDETHAEAHKRARDLATA


>Snas_2531 NAD(P)H dehydrogenase (quinone)
ATGTCAGTACTGCTGCACGTCGACTCGAGCATCAACGGCGACAACTCGCACTCCCGCAAG
GTGACCGCCACCTTCGCCAAGGAATGGCAGGCCGCCAACCCGCAGGGCCGCTACATCTAC
CGGGACGTAGCCGCCGACCCTATCCCCCACATCGACGCCGTCACCTACGGCGCCATCAAT
TCCCCTGAATCCGAGCACACCCCCGAGCAGGCCGAGGCCTTCGGTCCGGCCAAGCACATC
ATCGACGAGGTCGTGGCCGCCGACACGATCCTGCTGGGTGTGCCCATGTACAACTTCTCG
GTTCCCTCCCACCTGAAGGCGTGGATGGACCGCATCGCCATCGGCCGGTTCTTCGCCGAC
GACGACGGCAAGAGTGAGCTCAGTGACAAGAAGTTCGTCATCGCGACCTCGCGCGGCGGC
TCCTACGCCCCGGGCACCCCGCGCCATCACTTCGACCACCAGGAGCCGTACCTGGAGCGG
TTCTTCGAGTTCCTGGGTGCCAAGGACCTCACCTTCCTGCACACCGAGATGGCGCTGTCC
CACGTGGTCCCGGCACTGGCGCAGTTCAAGCACATCTACGACGAGACCCACGCCGAGGCC
CACAAGCGGGCCCGCGACCTCGCCACCGCCTAG


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)