English site

CDS : Snov_2532

CDS Description

CDSSnov_2532
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP002026
location2651432..2652043
NBRC No.14993
MicrobeStarkeya novella
Current status
>Snov_2532 NAD(P)H dehydrogenase (quinone)
MSATSSNRTLLHIDSSILGGHSVSRQVTAAIVARLTAADPSLGVVYRDLAAEPLPHATPA
SMPADHPLSGGKGDAASQQALDEFLAADIVVIGAPMYNFSVPTQLRAWIDRILVPGKTFA
YGADGKVAGLAGGKRVIVALARGGHYGDPVATEAGEHAETYLRWVFGFIGIEPEFVKADG
IAAGQRESALEGALRSAAELQAA


>Snov_2532 NAD(P)H dehydrogenase (quinone)
ATGAGCGCAACTTCGTCGAACCGCACCCTTCTGCACATCGATTCCTCCATCCTCGGCGGC
CATTCGGTGAGCCGCCAGGTCACCGCGGCGATCGTCGCCCGTCTCACCGCCGCCGACCCC
TCGCTCGGCGTCGTCTATCGCGACCTCGCGGCCGAGCCGCTGCCGCACGCGACGCCGGCC
AGCATGCCGGCCGACCATCCGCTCTCCGGCGGCAAGGGCGACGCCGCGAGCCAGCAGGCG
CTGGACGAGTTCCTCGCCGCCGACATCGTGGTCATCGGCGCGCCGATGTACAATTTCTCC
GTCCCCACCCAGCTTCGGGCGTGGATCGACCGCATCCTCGTGCCGGGCAAGACCTTCGCC
TATGGCGCGGACGGCAAGGTGGCCGGCCTCGCCGGCGGCAAGCGGGTGATCGTTGCGCTG
GCGCGCGGCGGCCATTACGGAGATCCGGTCGCCACCGAGGCGGGCGAGCATGCCGAGACC
TATCTGCGCTGGGTGTTCGGCTTCATCGGCATCGAGCCGGAATTCGTGAAGGCCGACGGC
ATCGCCGCCGGGCAGCGCGAGAGCGCGCTGGAAGGCGCGCTGAGGAGCGCGGCCGAGCTG
CAGGCGGCGTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)