English site

CDS : Spopo_31_08700

CDS Description

CDSSpopo_31_08700
Product nameFMN-dependent NADH-azoreductase
Gene nameazoR
ContigAQZX01000031
location918108..918728
NBRC No.12702
MicrobeSporichthya polymorpha
Current statusImproved High-Quality Draft
>Spopo_31_08700 FMN-dependent NADH-azoreductase
MPHLLHLDSSLRSEGSRSRRLSAHYAKLWRTAHPDGTVAYRDLAADPIPHLDEAGFTAAF
TPEADRTPEQNDSFKISTELIDELVAADTVVIGLPLYNFNVPSTFKAWFDRIVSERTLGQ
LTGTKLVVVTASGGGYGPGTPREGWDHREPWLRHAVTNLGITDVTFVGAELTLARESPQM
IPLDLGAAEDQSFADALAAIEELLAA


>Spopo_31_08700 FMN-dependent NADH-azoreductase
ATGCCTCACCTCCTACACCTCGACTCGTCCCTCCGGTCGGAGGGCTCACGCAGCCGCCGC
CTCTCCGCGCACTACGCCAAGCTCTGGCGGACGGCACATCCCGACGGCACGGTCGCCTAC
CGCGACCTGGCCGCCGACCCGATCCCGCACCTCGACGAGGCCGGCTTCACCGCGGCCTTC
ACGCCGGAGGCGGACCGCACTCCGGAGCAGAACGACTCGTTCAAGATCAGCACCGAGCTG
ATCGACGAACTGGTCGCGGCCGACACCGTCGTCATCGGGCTGCCGCTCTACAACTTCAAC
GTCCCCAGCACCTTCAAGGCCTGGTTCGACCGCATCGTCTCCGAACGGACGCTGGGTCAG
CTGACGGGGACGAAGCTCGTCGTCGTCACCGCCAGCGGTGGTGGCTACGGCCCCGGCACC
CCGCGCGAGGGCTGGGACCACCGCGAGCCGTGGCTGCGCCACGCGGTCACCAACCTCGGC
ATCACCGACGTCACCTTCGTCGGCGCCGAGCTCACCCTGGCCCGCGAGTCGCCGCAGATG
ATCCCGCTGGACCTCGGGGCCGCGGAGGACCAGAGCTTCGCCGACGCTCTCGCGGCGATC
GAGGAACTGCTCGCCGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)