English site

CDS : Swit_2250

CDS Description

CDSSwit_2250
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP000699
location2506406..2507038
NBRC No.105917
MicrobeSphingomonas wittichii
Current status
>Swit_2250 NAD(P)H dehydrogenase (quinone)
MARLLHIDASPRGARSRSNMVADRLIAGLAGHDIERLALFDADLPAFDGAAIEGRYALIE
GRPVDEAVRADWAAIGRMVDHFLSFDGWLLTVPMWNFGIPYRLKHYIDLITQPGLAFRVV
DGQGEGLAAGRRAILVTSGALDIRPGGPMAAYDFQLAYLRTWLGFIGVTDVDAIHVRPTY
GDEASVAAAMDRAYAEVDALLSGLSLPARV


>Swit_2250 NAD(P)H dehydrogenase (quinone)
ATGGCTAGGCTGTTGCACATCGACGCGAGCCCGCGCGGCGCGCGATCGCGGTCGAACATG
GTGGCGGACCGGCTGATCGCCGGGCTCGCCGGGCACGACATCGAGCGGCTGGCGCTGTTC
GACGCCGACCTGCCCGCCTTCGACGGCGCCGCGATCGAGGGGCGCTATGCGCTGATCGAG
GGCCGGCCGGTCGACGAGGCGGTGCGCGCCGACTGGGCGGCGATCGGCCGGATGGTCGAT
CATTTCCTGTCGTTCGACGGCTGGCTCCTGACCGTGCCGATGTGGAATTTCGGCATCCCC
TACCGGCTCAAGCATTATATCGACCTGATCACCCAGCCCGGCCTGGCCTTCCGGGTGGTC
GACGGGCAGGGCGAGGGGCTGGCGGCCGGCCGCCGCGCGATCCTGGTCACCTCGGGCGCG
CTCGACATCCGGCCCGGCGGGCCGATGGCGGCCTATGATTTCCAGCTCGCCTATCTCAGG
ACCTGGCTTGGCTTCATCGGCGTCACCGACGTCGACGCGATCCATGTCCGCCCCACCTAT
GGCGACGAGGCGAGCGTCGCGGCGGCGATGGATCGCGCCTATGCCGAGGTCGACGCGCTG
CTCTCCGGCCTCTCCCTGCCGGCGCGGGTATAG


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)