English site

CDS : Tcur_2797

CDS Description

CDSTcur_2797
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigCP001738
location3262005..3262652
NBRC No.15933
MicrobeThermomonospora curvata
Current status
>Tcur_2797 NAD(P)H dehydrogenase (quinone)
MARLLHIDSSPMGDMSVSRGLAAAFRARWEEELPTGTVVYRDVCADPLPLLDRDAIMTFY
MPEEARTQAQAEAARYRTALAEELLSADAVLVSAPMHNWTIPAHLKAWLDQVLIDGVTLV
QPGETHPLAGRPATVVLAYGGGYTPDAPLAGWDHVEPYLRTVFAGALQMELSVITAQLTL
VNEPPELAELARKSRREAEAAIEERARKVAAQLAG


>Tcur_2797 NAD(P)H dehydrogenase (quinone)
ATGGCCCGACTGCTGCACATCGACTCTTCGCCCATGGGCGACATGTCTGTCTCCCGCGGG
CTGGCGGCGGCCTTCCGCGCCCGCTGGGAGGAGGAGCTTCCCACCGGCACCGTCGTCTAC
CGGGACGTGTGCGCCGACCCGCTCCCGCTGCTGGACCGGGACGCCATCATGACGTTCTAC
ATGCCGGAGGAGGCCCGTACGCAGGCGCAGGCCGAGGCGGCACGGTACCGCACCGCGCTG
GCCGAGGAGCTGCTGTCGGCCGACGCCGTGCTGGTGAGCGCGCCGATGCACAACTGGACC
ATTCCCGCGCACCTCAAGGCGTGGCTGGACCAGGTGCTGATCGATGGCGTGACCCTGGTC
CAGCCGGGGGAGACGCACCCGCTGGCCGGCCGGCCGGCGACCGTGGTACTCGCCTACGGC
GGCGGCTACACCCCCGACGCCCCGCTGGCCGGCTGGGACCACGTCGAGCCGTATCTGCGG
ACGGTCTTCGCAGGTGCCCTGCAGATGGAACTGTCGGTCATCACAGCGCAGCTGACGCTC
GTCAACGAGCCGCCGGAGCTGGCGGAACTGGCGCGCAAGTCGCGGCGCGAGGCCGAGGCC
GCCATCGAGGAGCGCGCCCGCAAGGTCGCCGCGCAGCTCGCCGGCTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)