English site

CDS : WFL_07530

CDS Description

CDSWFL_07530
Product nameazoreductase
Gene nameazoR
ContigCP002967
location1584882..1585487
NBRC No.13500
MicrobeEscherichia coli
Current status
>WFL_07530 azoreductase
MSKVLVLKSSILAGYSQSNQLSDYFVEQWREKHSADEITVRDLAANPIPVLDGELVGALR
PSDAPLTPRQQEALALSDELIAELKAHDVIVIAAPMYNFNISTQLKNYFDLVARAGVTFR
YTENGPEGLITGKKAIVITSRGGIHKDGPTDLVTPYLSTFLGFIGITDVKFVFAEGIAYG
PEMAAKAQSDAKAAIDSIVAA


>WFL_07530 azoreductase
ATGAGCAAGGTATTAGTTCTTAAATCCAGCATCCTGGCAGGGTACTCTCAGTCTAATCAA
TTGTCCGATTATTTTGTTGAACAATGGCGCGAAAAGCACTCCGCTGATGAAATCACCGTT
CGCGACCTGGCTGCAAATCCGATTCCGGTACTGGATGGCGAACTGGTTGGCGCTCTGCGT
CCGAGCGATGCGCCGCTGACTCCGCGTCAGCAGGAAGCTCTGGCGCTTTCCGATGAGCTG
ATTGCCGAGCTGAAAGCCCACGACGTTATCGTTATTGCGGCACCGATGTATAACTTCAAC
ATCTCAACTCAGTTGAAAAACTATTTTGACCTGGTTGCACGCGCAGGCGTTACTTTTCGC
TATACCGAGAACGGTCCGGAAGGTCTGATAACGGGTAAAAAAGCCATCGTTATTACCAGC
CGCGGTGGGATCCACAAAGATGGACCAACGGACCTGGTGACGCCGTATCTGTCCACGTTC
CTCGGCTTTATCGGCATTACCGATGTGAAATTTGTCTTCGCCGAAGGGATCGCATACGGT
CCGGAAATGGCAGCGAAAGCGCAGTCTGACGCGAAAGCGGCCATCGACAGCATTGTTGCT
GCATAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)