English site

CDS : WYK_237_00070

CDS Description

CDSWYK_237_00070
Product nameazoreductase
Gene nameyvaB
ContigAJTN02000237
location4568..5203
NBRC No.101233
MicrobeBacillus psychrosaccharolyticus
Current status
>WYK_237_00070 azoreductase
MAKVLYITAHPHDDTQSYSMAVGKAFIDTYKEANPNDEIVNVDLYNENIPQIDVDVFSGW
GKLQSGKGFEELSADEKAKVGRLSELCEQFISADKYVFVTPLWNFSFPPVLKAYIDSVSV
AGKTFKYTEQGPVGLLTDKKALHIQSRGGIYSEGPAAQLEMGHRYLNVVMQFYGVPSFEG
LFVEGHAAMPDKAQEIKENAIARAKDLAHTF


>WYK_237_00070 azoreductase
ATGGCAAAAGTATTGTATATTACAGCACATCCACATGATGATACTCAGTCTTATAGTATG
GCAGTAGGTAAAGCCTTTATTGATACCTACAAAGAAGCAAATCCTAATGACGAAATTGTT
AATGTTGATCTTTATAACGAGAATATTCCACAAATAGATGTTGATGTTTTTAGTGGTTGG
GGAAAACTCCAATCAGGGAAGGGATTTGAAGAGCTATCAGCAGATGAAAAGGCAAAAGTA
GGTAGATTATCAGAACTATGTGAACAATTTATTTCAGCTGATAAGTATGTTTTCGTAACA
CCTTTGTGGAATTTTTCTTTCCCACCAGTATTAAAAGCTTATATTGATTCAGTTTCTGTT
GCTGGAAAAACATTTAAATACACAGAACAAGGTCCAGTAGGTCTGTTAACTGATAAAAAA
GCTTTACATATACAATCTCGTGGGGGGATTTATTCAGAAGGTCCAGCTGCTCAATTGGAA
ATGGGTCACCGCTATTTAAATGTTGTAATGCAATTCTATGGAGTCCCTTCGTTTGAAGGC
TTATTTGTAGAAGGACATGCAGCAATGCCAGATAAAGCACAAGAAATTAAGGAAAATGCA
ATTGCACGAGCTAAGGATCTAGCCCATACATTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)