English site

CDS : Y75_1404

CDS Description

CDSY75_1404
Product nameNADH-azoreductase, FMN-dependent
Gene nameazoR
ContigAP009048
location1483969..1484574
NBRC No.12713
MicrobeEscherichia coli
Current status
>Y75_1404 NADH-azoreductase, FMN-dependent
MSKVLVLKSSILAGYSQSNQLSDYFVEQWREKHSADEITVRDLAANPIPVLDGELVGALR
PSDAPLTPRQQEALALSDELIAELKAHDVIVIAAPMYNFNISTQLKNYFDLVARAGVTFR
YTENGPEGLVTGKKAIVITSRGGIHKDGPTDLVTPYLSTFLGFIGITDVKFVFAEGIAYG
PEMAAKAQSDAKAAIDSIVSA


>Y75_1404 NADH-azoreductase, FMN-dependent
ATGAGCAAGGTATTAGTTCTTAAATCCAGCATCCTGGCAGGGTACTCTCAGTCTAATCAG
TTGTCCGATTATTTTGTTGAACAATGGCGCGAAAAGCACTCCGCTGATGAAATCACCGTT
CGCGACCTGGCTGCAAATCCGATTCCGGTACTGGATGGCGAACTGGTTGGCGCTCTGCGT
CCGAGCGATGCGCCGCTGACTCCGCGTCAGCAGGAAGCTCTGGCACTTTCCGATGAGTTG
ATTGCCGAGCTGAAAGCCCACGACGTTATCGTTATTGCGGCACCGATGTATAACTTCAAC
ATCTCGACTCAGTTGAAAAACTATTTTGACCTGGTTGCCCGCGCAGGCGTTACTTTCCGC
TATACCGAGAACGGTCCGGAAGGTCTGGTAACGGGTAAAAAAGCCATCGTTATTACCAGC
CGCGGCGGGATCCACAAAGATGGACCAACGGACCTGGTGACGCCGTATCTGTCCACGTTC
CTCGGCTTTATCGGCATTACCGATGTGAAATTTGTCTTCGCCGAAGGGATCGCATACGGT
CCGGAAATGGCAGCGAAAGCACAGTCTGACGCAAAAGCAGCCATCGACAGCATTGTTTCT
GCATAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)