English site

CDS : bmyco0001_16910

CDS Description

CDSbmyco0001_16910
Product nameFMN-dependent NADH-azoreductase 1
Gene name
ContigACMU01000037
location139442..140143
NBRC No.101228
MicrobeBacillus mycoides
Current status
>bmyco0001_16910 FMN-dependent NADH-azoreductase 1
VKKMGLFSSLFGKKEENTKVEGNKTMSKVLFVKANDRPAEQAISSKMYETFVSAYKEANP
NTEITELDLFALDLPYYGNIAISGGYKRSQGMEITAEEEKAVATVDKYLNQFLEAEKVVF
AFPLWNFTVPAPLITYISYLSQAGKTFKYTANGPEGLAGDKKVVVLGARGSDYSSEQMAP
MEMAVNYVTNVLGFWGITNPETVVIEGHNQYPDRSQQIVEEGLENVKKVAAKF


>bmyco0001_16910 FMN-dependent NADH-azoreductase 1
GTGAAGAAAATGGGGTTATTTAGCTCATTGTTTGGTAAAAAAGAAGAAAATACAAAAGTA
GAGGGGAATAAAACAATGTCAAAAGTATTATTTGTAAAAGCAAACGATCGTCCAGCGGAG
CAAGCAATTAGTTCAAAAATGTATGAAACATTTGTAAGTGCTTATAAGGAAGCAAATCCG
AATACAGAAATCACGGAGTTAGATTTATTTGCATTAGATCTTCCGTATTACGGAAATATC
GCTATTTCAGGTGGATATAAACGTAGTCAAGGAATGGAGATAACAGCTGAAGAAGAGAAG
GCAGTTGCTACAGTAGATAAATATTTAAATCAATTTTTAGAGGCTGAAAAGGTTGTATTT
GCGTTCCCATTATGGAACTTTACAGTACCAGCACCATTAATTACGTATATTTCATATCTT
TCTCAAGCTGGAAAAACGTTTAAATATACAGCGAACGGTCCAGAAGGTTTAGCTGGTGAT
AAGAAAGTAGTTGTTTTAGGCGCTCGTGGTTCAGATTACTCTTCTGAACAAATGGCTCCT
ATGGAAATGGCTGTTAATTACGTTACAAACGTACTTGGGTTCTGGGGAATTACCAATCCA
GAGACAGTTGTAATTGAGGGACACAATCAATATCCAGATCGCTCACAGCAAATTGTTGAA
GAAGGTTTAGAGAACGTTAAGAAAGTAGCGGCGAAATTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)