English site

CDS : bmyco0001_19650

CDS Description

CDSbmyco0001_19650
Product nameFMN-dependent NADH-azoreductase 2
Gene name
ContigACMU01000042
location55251..55886
NBRC No.101228
MicrobeBacillus mycoides
Current status
>bmyco0001_19650 FMN-dependent NADH-azoreductase 2
MTKVLFITANPNSAEGSFGMAVGEAFIEAYKNEHPQDEVVTIDLFNTTVPAIDADVFAAW
GKFAAGEGFETLSENQQQKVAAMNNNLETFMHADRYVFVTPMWNFSYPAVVKAYLDNLSI
AGKTFKYTENGPVGLLEGKKALHIQATGGVYSEGAYASMDFGRNHLNAVLGFMGVSDTEY
IAVEGMNANPEKAQDIKEAAIVNARELAKRF


>bmyco0001_19650 FMN-dependent NADH-azoreductase 2
ATGACAAAAGTACTATTTATTACAGCAAATCCAAATTCAGCAGAAGGTTCTTTCGGTATG
GCAGTAGGGGAAGCTTTCATCGAAGCATATAAAAACGAACATCCACAAGACGAAGTTGTA
ACAATTGATTTATTCAATACAACTGTACCAGCAATCGATGCAGACGTATTCGCTGCTTGG
GGTAAATTTGCAGCAGGCGAAGGATTCGAAACTTTAAGTGAAAATCAGCAACAAAAAGTT
GCAGCAATGAACAATAACTTAGAAACATTTATGCATGCAGATCGTTATGTATTCGTGACT
CCAATGTGGAACTTCAGCTACCCAGCAGTAGTGAAAGCATACTTAGATAACTTATCAATC
GCAGGTAAAACATTCAAATATACTGAAAATGGTCCAGTTGGCTTACTAGAAGGCAAAAAA
GCACTTCATATTCAAGCTACAGGCGGCGTTTACTCTGAAGGAGCATACGCATCTATGGAC
TTCGGTCGCAATCACTTAAATGCGGTATTAGGATTCATGGGTGTATCAGACACTGAATAT
ATTGCAGTTGAAGGAATGAATGCAAATCCTGAAAAAGCACAAGACATTAAAGAAGCAGCG
ATTGTAAATGCACGCGAATTAGCAAAACGTTTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)