English site

CDS : bmyco0001_19940

CDS Description

CDSbmyco0001_19940
Product nameNADPH azoreductase
Gene name
ContigACMU01000044
location23619..24155
NBRC No.101228
MicrobeBacillus mycoides
Current status
>bmyco0001_19940 NADPH azoreductase
MRLVVINGTPRKFGRTRVVAKYIAEQFEGELYDLAVAELPLYNGEESQRELEAVKKLKAL
VKAADGVVLCTPEYHNAMSGALKNSLDYLSSSEFIHKPVALLAVAGGGKGGINALNSMRI
VARGVYANAIPKQVVLDGLHVQDGELGEDAKPLIHDLVKELKAYMSVYKEVKKQLGVE


>bmyco0001_19940 NADPH azoreductase
ATGAGACTAGTCGTTATTAACGGTACACCAAGAAAGTTCGGTAGAACTCGCGTCGTGGCA
AAATATATTGCAGAGCAATTTGAAGGGGAGTTATACGATTTAGCAGTAGCGGAATTGCCT
TTATATAATGGAGAAGAATCACAACGTGAATTAGAGGCAGTAAAAAAATTAAAAGCTTTA
GTGAAAGCTGCGGATGGAGTAGTACTATGTACACCGGAATATCATAATGCGATGAGTGGA
GCGCTGAAAAATTCGTTAGATTACTTAAGTAGCAGTGAATTCATCCATAAGCCTGTCGCA
TTACTAGCAGTTGCTGGAGGAGGTAAAGGGGGAATAAACGCATTAAATAGTATGCGTATT
GTAGCTAGAGGCGTTTACGCAAATGCAATCCCAAAACAAGTAGTACTTGATGGATTACAT
GTGCAAGATGGTGAACTGGGAGAAGATGCAAAACCATTGATTCATGATTTAGTTAAAGAA
TTAAAAGCATATATGAGCGTATATAAAGAGGTGAAAAAACAACTAGGAGTTGAGTGA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)