English site

CDS : bpmyx0001_19910

CDS Description

CDSbpmyx0001_19910
Product nameFMN-dependent NADH-azoreductase 2
Gene name
ContigACMX01000036
location50455..51090
NBRC No.101232
MicrobeBacillus pseudomycoides
Current status
>bpmyx0001_19910 FMN-dependent NADH-azoreductase 2
MTKVLFITANPNSAEASFGMAVGESFIEAYKNEHPQDEVVTIDLFNTAVPAIDAEVFTAW
GKFAAGEGFETLSESQQQKIAAMNTNLETFMNADRYVFVTPMWNFSYPPVVKAYLDNLSI
AGKTFKYTENGPVGLLEGKKALHIQATGGVYSEGPYAAMDFGRKHLNAVLGFMGISDVDY
LAVEGMNANPEKAPEIKEAAIANARELAKRF


>bpmyx0001_19910 FMN-dependent NADH-azoreductase 2
ATGACAAAAGTACTATTTATTACAGCAAATCCAAATTCAGCAGAAGCATCTTTCGGTATG
GCAGTAGGGGAATCATTCATCGAAGCATATAAAAATGAACATCCACAAGATGAAGTGGTA
ACAATTGATCTATTTAACACAGCTGTACCAGCAATTGATGCAGAAGTATTTACAGCTTGG
GGTAAATTTGCAGCAGGTGAAGGCTTTGAAACGTTAAGCGAAAGCCAACAACAAAAAATT
GCAGCAATGAATACAAACTTAGAAACATTTATGAATGCAGATCGTTATGTGTTTGTAACG
CCAATGTGGAACTTTAGTTATCCACCAGTAGTAAAAGCATACTTAGATAACTTGTCTATC
GCAGGTAAAACTTTTAAATATACTGAAAACGGACCAGTTGGTTTACTAGAAGGGAAAAAA
GCACTTCACATTCAAGCTACAGGTGGCGTTTACTCTGAAGGACCATACGCAGCAATGGAC
TTTGGCCGCAAGCACTTAAATGCAGTATTAGGATTTATGGGTATATCTGATGTAGACTAC
CTTGCGGTTGAAGGTATGAATGCAAACCCTGAAAAAGCACCAGAAATTAAAGAAGCGGCA
ATTGCAAATGCTCGCGAATTAGCAAAACGTTTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)