English site

CDS : bpmyx0001_20140

CDS Description

CDSbpmyx0001_20140
Product nameNADPH azoreductase
Gene name
ContigACMX01000036
location70471..71007
NBRC No.101232
MicrobeBacillus pseudomycoides
Current status
>bpmyx0001_20140 NADPH azoreductase
MKLVVINGTPRKFGRTRVIAKYIAEQFEGELYDLATEQLPLYNGEESQRELEAVTKLKTI
VKEADGVVLCTPEYHNAMSGALKNALDFLSSSEFVHKPVALLAVAGGGKGGINALNSMRI
VARGVYANAIPKQVVLDGLYVQDGELSEDAKPLIHDLFKELKAYMSVYKEVKKQLGVE


>bpmyx0001_20140 NADPH azoreductase
ATGAAATTAGTTGTAATTAACGGAACACCACGTAAATTTGGTAGAACACGTGTCATTGCA
AAATATATTGCAGAACAATTTGAAGGAGAGTTATATGATTTAGCAACAGAACAATTGCCT
TTATATAACGGTGAAGAATCACAACGTGAACTAGAAGCGGTAACTAAATTAAAAACAATA
GTGAAAGAAGCTGATGGTGTTGTCCTTTGCACACCTGAATATCATAATGCGATGAGTGGT
GCGCTCAAAAATGCATTAGATTTCTTAAGTAGCAGTGAATTTGTCCATAAACCAGTTGCT
TTATTGGCGGTTGCAGGCGGCGGAAAAGGCGGTATAAACGCGCTTAATAGCATGCGGATT
GTCGCGCGAGGCGTATATGCAAATGCGATTCCAAAACAAGTTGTACTAGACGGTTTATAC
GTACAAGATGGTGAACTTAGTGAAGATGCAAAACCATTAATTCATGATCTTTTCAAAGAG
TTAAAAGCATATATGAGCGTGTATAAAGAAGTGAAAAAGCAATTAGGGGTGGAGTGA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)