English site

CDS : bpmyx0001_8310

CDS Description

CDSbpmyx0001_8310
Product nameFMN-dependent NADH-azoreductase 1
Gene name
ContigACMX01000021
location73194..73820
NBRC No.101232
MicrobeBacillus pseudomycoides
Current status
>bpmyx0001_8310 FMN-dependent NADH-azoreductase 1
MTTVLFVKANNRPAEQAVSVKLYEAFLASYKESHPNDTVVELDLYNEELPYVGVDMINGT
FKSGRGVDLTAEEAKAVAVADKYLDQFLAADKVVFAFPLWNLTIPAVLHTYIDYLNRTGK
TFKYTPEGPVGLIGDKKVALLNASGGVYSKGPKAEMEMAIKYVVSMMGFFGAKDIEKVVI
EGHNQFPDKAEEIIAAGLEKAIKVASTF


>bpmyx0001_8310 FMN-dependent NADH-azoreductase 1
ATGACAACAGTTTTATTTGTAAAAGCAAACAATCGTCCAGCAGAACAAGCAGTTAGTGTG
AAATTATATGAGGCTTTTTTAGCAAGTTATAAAGAATCACATCCAAATGATACAGTGGTA
GAGCTTGATTTATACAATGAAGAATTACCATATGTAGGAGTAGATATGATTAACGGGACA
TTTAAGTCTGGTAGAGGAGTTGATTTAACAGCAGAAGAAGCAAAAGCAGTAGCTGTTGCT
GATAAATATTTAGATCAATTCCTTGCAGCTGATAAAGTTGTGTTTGCTTTCCCATTATGG
AACTTAACAATCCCAGCTGTACTACACACATATATTGATTACTTAAACCGCACGGGCAAA
ACATTTAAATATACGCCAGAAGGTCCAGTAGGTCTTATTGGAGATAAGAAAGTTGCATTA
TTAAATGCAAGTGGCGGTGTATATTCGAAAGGCCCAAAAGCTGAAATGGAAATGGCTATT
AAATATGTAGTAAGTATGATGGGCTTCTTCGGTGCAAAAGATATAGAGAAAGTAGTGATT
GAAGGACACAATCAATTCCCTGATAAAGCAGAAGAGATTATTGCTGCAGGGCTTGAAAAA
GCGATTAAAGTAGCAAGTACGTTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)