English site

CDS : bthur0008_20330

CDS Description

CDSbthur0008_20330
Product nameFMN-dependent NADH-azoreductase 2
Gene name
ContigACNF01000055
location32486..33154
NBRC No.101235
MicrobeBacillus thuringiensis
Current status
>bthur0008_20330 FMN-dependent NADH-azoreductase 2
LKIKRKKGENTMTKVLFITANPNSAEGSFGMAVGEAFIEAYKNEHPQDEVVTIDLFNTTV
PAIDADVFAAWGKFAAGEGFETLTEAQQQKVAAMNTNLETFMHADRYVFVTPMWNFSYPP
VVKAYLDNVAIAGKTFKYTENGPVGLLEGKKALHIQATGGVYSEGAYAAVDFGRNHLKTV
LGFVGVNDTDYIAVEGMNANPEKAQEIKEAAIANARELAKRF


>bthur0008_20330 FMN-dependent NADH-azoreductase 2
TTGAAGATAAAAAGAAAAAAGGGAGAGAATACAATGACAAAAGTACTATTTATCACAGCA
AATCCAAATTCAGCAGAAGGTTCTTTCGGAATGGCAGTAGGGGAAGCTTTCATCGAGGCT
TATAAAAACGAGCATCCACAAGACGAAGTTGTAACAATTGATCTATTCAATACTACTGTA
CCAGCAATCGATGCAGATGTATTTGCTGCTTGGGGTAAATTTGCAGCAGGTGAAGGCTTT
GAAACTTTAACGGAAGCTCAACAACAAAAAGTAGCAGCAATGAACACAAACTTAGAAACA
TTTATGCATGCAGATCGTTATGTATTCGTAACTCCAATGTGGAACTTTAGCTATCCACCA
GTAGTAAAAGCATACTTAGATAACGTAGCAATCGCAGGTAAAACATTCAAATATACTGAA
AATGGTCCAGTCGGCTTATTAGAAGGTAAAAAAGCACTTCACATTCAAGCAACAGGTGGC
GTATATTCTGAAGGAGCATACGCAGCTGTAGACTTCGGACGCAATCATTTAAAAACTGTA
TTAGGATTTGTCGGTGTAAATGATACTGATTATATTGCAGTTGAGGGTATGAATGCAAAC
CCTGAAAAAGCACAAGAAATTAAAGAAGCGGCAATTGCTAATGCTCGTGAATTAGCAAAA
CGTTTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)