English site

CDS : bthur0008_20920

CDS Description

CDSbthur0008_20920
Product nameNADPH azoreductase
Gene name
ContigACNF01000058
location8172..8654
NBRC No.101235
MicrobeBacillus thuringiensis
Current status
>bthur0008_20920 NADPH azoreductase
VAKYIADQFEGELYDLAIEELPLYNGEESQRDLEAVKKLKTLVKAADGVVLCTPEYHNAM
SGALKNSLDYLSSSEFIHKPVALLAVAGGGKGGINALNSMRTVSRGVYANAIPKQVVLDG
LHVQDGELGEDAKPLIHDVVKELKAYMSVYKEVKKQLGVE


>bthur0008_20920 NADPH azoreductase
GTGGCAAAATATATTGCGGATCAATTTGAAGGGGAATTATATGATTTAGCAATTGAGGAG
TTACCTTTATACAATGGAGAAGAGTCACAACGTGATTTAGAGGCAGTAAAAAAATTGAAA
ACATTAGTGAAAGCTGCGGATGGGGTTGTATTATGTACACCAGAATATCATAATGCGATG
AGCGGTGCGCTGAAAAACTCTTTAGATTACTTAAGTAGTAGTGAATTTATTCATAAACCA
GTTGCGTTGTTAGCGGTTGCTGGTGGCGGTAAAGGTGGAATAAATGCATTAAACAGCATG
CGAACGGTCTCTAGAGGTGTTTATGCAAATGCCATTCCAAAACAAGTTGTGCTTGATGGA
TTACATGTGCAAGATGGTGAACTTGGGGAAGATGCCAAACCATTAATTCATGATGTAGTT
AAAGAATTAAAAGCATATATGAGCGTATATAAAGAGGTGAAAAAGCAACTAGGAGTGGAG
TGA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)