English site

CDS : bthur0008_51860

CDS Description

CDSbthur0008_51860
Product nameFMN-dependent NADH-azoreductase 1
Gene name
ContigACNF01000111
location55969..56595
NBRC No.101235
MicrobeBacillus thuringiensis
Current status
>bthur0008_51860 FMN-dependent NADH-azoreductase 1
MATVLFVKANNRPAEQAVSVKLYEAFLANYKEAHPNDTVVELDLYKEELPYVGVDMINGT
FKAGKGFDLTEEEAKAVAVADKYLNQFLEADKVVFGFPLWNLTIPAVLHTYIDYLNRAGK
TFKYTPEGPVGLIGDKKIALLNARGGVYSEGPAAEVEMAVKYVASMMGFFGATNMETVII
EGHNQFPDKAEEIIAAGLEEAAKVASKF


>bthur0008_51860 FMN-dependent NADH-azoreductase 1
ATGGCAACAGTTTTATTCGTTAAAGCAAACAACCGTCCAGCGGAACAAGCAGTTAGTGTA
AAATTATATGAGGCATTTTTAGCAAACTATAAAGAAGCACACCCAAATGATACAGTAGTA
GAACTGGATTTATATAAAGAAGAATTACCATATGTAGGTGTAGACATGATCAATGGTACA
TTCAAGGCAGGTAAAGGATTTGATTTAACAGAAGAAGAGGCAAAAGCAGTAGCAGTTGCT
GATAAGTATTTAAATCAATTCCTAGAAGCTGATAAAGTTGTTTTCGGCTTCCCATTATGG
AACTTAACGATTCCAGCAGTGTTACACACATATATTGATTATTTAAACCGTGCTGGTAAA
ACGTTCAAATATACGCCAGAGGGTCCAGTTGGCCTAATCGGTGATAAGAAGATTGCATTA
TTAAATGCACGAGGCGGCGTATATTCAGAAGGTCCAGCAGCTGAGGTAGAAATGGCTGTT
AAATATGTAGCAAGTATGATGGGCTTCTTCGGCGCAACAAACATGGAAACAGTAATTATT
GAAGGACATAACCAATTCCCAGATAAAGCAGAAGAAATCATTGCTGCAGGTCTTGAAGAA
GCAGCTAAAGTAGCAAGTAAATTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)