English site

CDS : yberc0001_22940

CDS Description

CDSyberc0001_22940
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigAALC02000001
location136532..137137
NBRC No.105717
MicrobeYersinia bercovieri
Current status
>yberc0001_22940 FMN-dependent NADH-azoreductase
MSKVLVLKSSILATYSQSNQLADFFVEQWQAAHAGDEITVRDLAAQPIPVLDGELVGALR
PSDAALTPRQQEALALSDELIAELQANDVIVMAAPMYNFSIPTQLKNYFDLIARAGVTFR
YTEKGPEGLITGKRAIILTSRGGIHKDTPTDLVVPYLRLFLGFIGITDVEFVFAEGIAYG
PEVATKAQADAKELLAQVISA


>yberc0001_22940 FMN-dependent NADH-azoreductase
ATGAGTAAAGTTCTGGTTCTGAAATCAAGCATTCTGGCAACTTATTCTCAGTCCAACCAA
TTGGCTGACTTTTTTGTTGAACAATGGCAAGCTGCCCACGCAGGTGACGAAATCACGGTA
CGTGATCTGGCCGCTCAACCGATTCCAGTGTTAGATGGCGAATTGGTGGGTGCTCTGCGC
CCTTCAGATGCGGCATTGACACCACGTCAGCAAGAAGCGCTGGCACTGTCTGATGAGTTG
ATTGCAGAGTTGCAAGCTAATGACGTGATTGTGATGGCTGCACCTATGTACAACTTCAGC
ATTCCAACTCAACTGAAAAACTATTTTGACCTGATTGCCCGTGCAGGTGTGACCTTCCGT
TACACCGAAAAAGGCCCTGAAGGTCTGATAACCGGCAAACGTGCCATCATTCTGACTAGC
CGTGGCGGTATTCATAAAGATACCCCAACTGACCTGGTTGTCCCTTACCTGCGTCTGTTC
CTGGGCTTTATCGGTATTACTGATGTTGAGTTCGTGTTCGCAGAAGGTATTGCTTATGGC
CCTGAAGTTGCCACCAAAGCACAGGCAGATGCGAAAGAGTTACTGGCACAGGTTATTAGC
GCTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)