English site

CDS : yrohd0001_26810

CDS Description

CDSyrohd0001_26810
Product nameFMN-dependent NADH-azoreductase
Gene name
ContigACCD01000001
location59235..59840
NBRC No.105715
MicrobeYersinia rohdei
Current status
>yrohd0001_26810 FMN-dependent NADH-azoreductase
MSKVLVLKSSILATYSQSNQLADFFAEQWQAAHAGDEITVRDLAAQPIPVLDGELVGAMR
PSDAALTPRQQEALALSDELIAELQANDVIVIAAPMYNFNIPTQLKNYFDLIARAGVTFR
YTEKGPEGLITGKRAIILTSRGGIHKDTPTDLVVPYLRLFLGFIGITDVEFVFAEGIAYG
PEVATKAQADAKELLTQVVSA


>yrohd0001_26810 FMN-dependent NADH-azoreductase
ATGAGCAAAGTACTGGTTCTGAAATCAAGCATCCTGGCAACATATTCACAGTCTAACCAA
TTGGCTGATTTTTTTGCTGAACAATGGCAAGCCGCCCATGCGGGTGATGAAATTACTGTA
CGTGACCTGGCTGCTCAACCGATTCCTGTATTAGATGGCGAGCTGGTCGGTGCAATGCGC
CCTTCAGATGCCGCCTTGACTCCACGCCAACAAGAAGCACTGGCGCTGTCTGATGAACTG
ATTGCTGAATTGCAGGCGAATGATGTGATTGTTATCGCCGCACCTATGTATAACTTCAAT
ATTCCGACACAGTTAAAGAACTATTTTGACCTGATTGCCCGTGCTGGCGTGACTTTCCGT
TACACCGAAAAAGGCCCAGAAGGCCTGATAACTGGCAAACGCGCTATTATTCTGACCAGC
CGTGGCGGTATTCATAAAGATACCCCTACTGACCTGGTTGTGCCTTACCTGCGTCTGTTC
CTGGGCTTTATCGGGATTACTGATGTTGAATTCGTGTTCGCAGAAGGTATTGCTTACGGC
CCTGAAGTGGCAACCAAAGCACAAGCAGATGCCAAAGAGTTACTGACTCAAGTGGTTAGC
GCATAG


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)